We narrowed to 43,256 results for: gats
-
Plasmid#19681DepositorInsertPpro-1
UseGateway entry cloneAvailable SinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
EKv408(Gold Cas-guide insert4)
Plasmid#248337PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv407(Gold Cas-guide insert3)
Plasmid#248336PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv406(Gold Cas-guide insert2)
Plasmid#248335PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv410(Gold Cas-guide insert6)
Plasmid#248339PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv411(Gold Cas-guide insert7)
Plasmid#248340PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv412(Gold Cas-guide insert8)
Plasmid#248341PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv405(Gold Cas-guide insert1)
Plasmid#248334PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv409(Gold Cas-guide insert5)
Plasmid#248338PurposegRNA insert vector for Golden Gate AssemblyDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-GADT7-RGS19
Plasmid#248656PurposeYeast 2-hybrid vector encoding the human regulator of G protein signaling RGS19 fused to the GAL4 DNA activation domain.DepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pR2B5
Plasmid#245486PurposepL1-R2-pAtUBI-RUBY-tRBCS (Golden Gate Level 1 module with a transcription unit expressing RUBY from the AtUBI promoter with the tRBC terminator for R2 position in Level 2 vector)DepositorInsertpAtUBI-RUBY-tRBCS
ExpressionPlantPromoterPolyubiquitin 10 gene from Arabidopsis thalianaAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pR2B6
Plasmid#245487PurposepL1-R2-pLsUBI-RUBY-tLsUBI (Golden Gate Level 1 module with a transcription unit expressing RUBY from the LsUBI promoter with the tLsUBI terminator for R2 position in Level 2 vector)DepositorInsertpLsUBI-RUBY-tLSUBI
ExpressionPlantPromoterPolyubiquitin 4 gene (LOC111919935) from lettuceAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP440
Plasmid#85937PurposeEncrypted AND gate, decryption step 1.DepositorInsertEncrypted AND gate, decryption step 1
ExpressionBacterialAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOP447
Plasmid#85938PurposeEncrypted AND gate, decryption step 2.DepositorInsertEncrypted AND gate, decryption step 2
ExpressionBacterialAvailable SinceJuly 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Venus_hs_NC_chr2
Plasmid#214683PurposeLentiviral expression vector for an inducible Cas9-P2A-Venus with two sgRNA sequences against human non-coding DNA region of chromosome 2 (negative control)DepositorInsertdgRNA_Chr2
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOpen-ECOligA
Plasmid#165564PurposeConnects preferentially cohesive double-stranded DNA ends, active on blunt end DNA in the presence of Ficoll or polyethylene glycol. Requires Mg2+ and NAD+. Ligation when blunt end or RNA/ DNA ligation needs to be avoided.DepositorInsertE. coli DNA Ligase
UseSynthetic BiologyAvailable SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
MS2592.EF1a.SLC6A1.S295L.RFP.P2A.PURO.JL.p163
Plasmid#170174PurposeLentiviral Expression of EF1a.SLC6A1.S295L.RFPDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.A288V.P2A.PURO.JL.p166
Plasmid#170171PurposeLentiviral Expression of EF1a.SLC6A1.A288VDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJQ200mp19
Plasmid#78501PurposeSuicide vector for allelic exchangeDepositorTypeEmpty backboneUseSuicide vector for gene replacementPromoternoneAvailable SinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only