We narrowed to 16,215 results for: grna
-
-
-
gh42
Plasmid#106716Purposeexpression of gRNA targeting ST6GALNAC1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertST6GALNAC1 (ST6GALNAC1 Human)
ExpressionMammalianAvailable sinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
gh45
Plasmid#106708Purposeexpression of gRNA targeting ST6GALNAC4DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertST6GALNAC4 (ST6GALNAC4 Human)
ExpressionMammalianAvailable sinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
p35C-epegRNA-ccdB
Plasmid#246791PurposeExpress pegRNA in plant cells (protoplast or callus) for prime editingDepositorInsertccdB
UseCRISPRAvailable sinceMarch 17, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHelper-CBE-sgRNA
Plasmid#221137PurposeHelper plasmid for sgRNA cloning for CRISPR-Cas9 cytosine base editing. sgRNA-scaffold with Cas9 handle expressed from constitutive bacterial promoter J23119(SpeI). 2 BbsI sites for sgRNA cloning.DepositorInsertsgRNA-scaffold with Cas9 handle
UseCRISPRExpressionBacterialPromoterJ23119(SpeI)Available sinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCherry U6-sgRNA (BsmBI)
Plasmid#214128PurposeMammalian continuous expressionDepositorInsertsgRNA
UseLentiviralExpressionMammalianMutationWTAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
ExpressionBacterialPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_CALR sgRNA / hSpCas9
Plasmid#172838PurposeMammalian expression of a sgRNA targeting the intron 1 of CALR (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting intron 1 of CALR under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-pegRNA_KCNA1-EGFP
Plasmid#159787PurposeS. pyogenes pegRNA for C to A mutation at the KCNA1 site of human cells using prime editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspacer of pegRNA targeting KCNA1 gene (KCNA1 Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA_VEGFA-mcherry
Plasmid#159790PurposeS. pyogenes sgRNA collocated with pegRNA targeting human VEGFA geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertspacer of sgRNA targeting VEGFA gene (VEGFA Human)
ExpressionMammalianAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only
