We narrowed to 16,117 results for: grna
-
Plasmid#112129Purposeempty sgRNA cloning vector with MS2-AID3fDepositorInsertAIDmono 3f mutant (AICDA Human)
UseCRISPRExpressionMammalianMutationN- mutated and C- terminal truncated, F115Y/C116F…PromoterhU6,CBhAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLL2 sgRNA(MS2)-MS2-AID3c
Plasmid#112128Purposeempty sgRNA cloning vector with MS2-AID3cDepositorInsertAID mono 3c mutant (AICDA Human)
UseCRISPRExpressionMammalianMutationN- mutated and C- terminal truncated, F115Y/C116F…PromoterhU6,CBhAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRi_dual_1_2
Pooled library#187246PurposeUltra-compact, human genome-wide CRISPRi library targeting each gene with a single element encoding a dual sgRNA cassette.DepositorSpeciesSyntheticUseLentiviralAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL3-U6-sgRNA-PGK- mRFP-T2A-PuroR
Plasmid#194925PurposemRFP and T2A linker are inserted in between the hPGK promoter and the puromycin resistance gene (PuroR) on pGL3-U6-sgRNA-PGK-puromycin to allow simultaneous monitoring and enrichment of transfected hoDepositorTypeEmpty backboneUseCRISPRPromoterhPGKAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Human Brunello kinome pooled library, guides 1-4 in lentiCRISPRv2 backbone
Pooled library#75314PurposeHuman sgRNA library in backbone lentiCRISPRv2 targeting 763 kinase genes and containing 3,052 unique sgRNAs along with 100 non-targeting controlsDepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
sg14x(MS2) MUC4.1
Plasmid#101153PurposegRNA with 14 MCP binding siteDepositorInsertMUC4 (MUC4 Human)
UseCRISPR and LentiviralAvailable sinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_SSRP1_2
Plasmid#72372PurposeEncodes gRNA for 3' target of human SSRP1 along with Cas9 with 2A GFPDepositorInsertSSRP1 (SSRP1 Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_TGIF2_1
Plasmid#72374PurposeEncodes gRNA for 3' target of human TGIF2 along with Cas9 with 2A GFPDepositorInsertTGIF2 (TGIF2 Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_TGIF2_2
Plasmid#72375PurposeEncodes gRNA for 3' target of human TGIF2 along with Cas9 with 2A GFPDepositorInsertTGIF2 (TGIF2 Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF146_1
Plasmid#72360PurposeEncodes gRNA for 3' target of human ZNF146 along with Cas9 with 2A GFPDepositorInsertZNF146 (ZNF146 Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Puro
Plasmid#214680PurposeLentiviral expression vector for an inducible Cas9-P2A-Puromycin resistance casette with two empty sgRNA cloning sitesDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-mCherry
Plasmid#240538PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with mCherry. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgRNA-EF1a-LibVec
Plasmid#239591PurposeAAV vector for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseAAVExpressionMammalianPromoterhU6Available sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT4-U6-sgRNA-CMV-EGFP
Plasmid#239587PurposeSleeping-beauty based EV for cloning and expression of sgRNAs - concomitant expression of GFP serves as transfection markerDepositorTypeEmpty backboneUseSleeping beauty transposoneExpressionMammalianPromoterhU6Available sinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUb-Cas9-mCherry_cU6:6-sgRNA
Plasmid#190598PurposeThe plasmid encodes S. pyogenes Cas9 and mCherry separated by a T2A peptide under an Aedes aegypti polyubiquitin promoter. It also expresses a sgRNA scaffold under a Culex quinquefasciatus U6 promoterDepositorInsertsCas9
sgRNA
UseCRISPRTagsmCherry - separated by T2APromoterAedes aegypti polyubiquitin and Culex quinquefasc…Available sinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 EMX1-nicking sgRNA
Plasmid#169859PurposeSpyCas9 nicking sgRNA for EMX1DepositorInsertSpyCas9 EMX1-nicking sgRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Sa sgRNA expression vector
Plasmid#107720PurposeFor in vitro transcription of Sa sgRNA from the T7 promoter.DepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-sgRNA_HPRT1_ex3-CBh-3xFLAG-NLS-Cas9-NLS-T2A-mCherry
Plasmid#250373PurposeVector expressing sgRNA against human HPRT1 exon 3 under U6 promoter and 3xFLAG-NLS-Cas9-NLS-T2A-mCherry under CBh promoter.DepositorAvailable sinceJuly 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-Sauri C aa439-1061-U6-Camk2d sgRNA7
Plasmid#220129PurposeExpresses Sauri cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSauri Cas9C
UseAAV and CRISPRExpressionMammalianPromoterMYL2Available sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only