We narrowed to 16,610 results for: grna
-
Plasmid#168281PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgPer1-3-hU6-sgPer2-1-hU6-sgPer2-2
UseAAVTagsmCherryPromoterU6, hSynAvailable SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pREDCas9
Plasmid#71541PurposeConstitutive expression of Cas9, inducible expression of the Red recombineering system, and inducible expression of the plasmid curing system for CRISPR mediated genome editing of E. coli.DepositorInsertsCas9
lambda red genes
plasmid curing system
ExpressionBacterialPromoterpBADAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
piggyFlex
Plasmid#218234PurposeA piggyBac transposon-based gRNA expression vector, to allow for genomic integration and stable expression of gRNAs. Contains both antibiotic (puromycin) and fluorophore (GFP) markers.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Actb KI #2
Plasmid#139666PurposeEndogenous tagging of β-actin: N-terminal (amino acid position: before startcodon)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
Plasmid#234883Purposenon-targeting CRISPRi controlDepositorInsertL1HS gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK1334
Plasmid#127965PurposesgRNA expression vector compatible with CROP-Seq and imaging screensDepositorInsertEF1a-Puro-T2A-2xmycNLS-WPRE-mU6-sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceAug. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-GFPg1 (BB09)
Plasmid#139461PurposeLentiviral vector with gRNA targeting GFP; includes puromycin selectable markerDepositorInsertGFP-targeting sgRNA inserted; resistance gene: puroR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK764
Plasmid#65767PurposeBacterial expression plasmid for SpCas9 & sgRNA (need to clone spacer into BsaI sites): T7-humanSpCas9-NLS-3xFLAG-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pORANGE unc13a GFP KI
Plasmid#131498PurposeEndogenous tagging of Munc13-1: C-terminal (amino acid position: A1762)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TOMM20
Plasmid#207789PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TOMM20 for knock-in.DepositorInsertsgRNA Targeting C-terminus of TOMM20 (TOMM20 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-BSD
Plasmid#216123PurposeMakes CRISPR gRNAs detectable by single-cell RNA-seq. The gRNA is expressed as part of the blasticidin resistance mRNA transcribed by RNA Pol II and in its functional form from the hU6 promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-GOLGA2
Plasmid#207791PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of GOLGA2 for knock-in.DepositorInsertsgRNA Targeting N-terminus of GOLGA2 (GOLGA2 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-KRAB-GFP backbone
Plasmid#194281PurposeVector for CRISPRi-GFP expression ready for gateway cloning of sgRNADepositorInsertdCas9-KRAB-GFP
UseCRISPR and LentiviralTagsGFPPromoterEF1aAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2517
Plasmid#91086PurposeModule C, Promoter: TaU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterTaU3Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgEGFP
Plasmid#86153PurposeLentivirus carrying Cas9/CRISPR for cut in GFP (used as control)DepositorInsertEGFP
UseCRISPR and LentiviralAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
B52 + SMARCAL1 sgSTOP
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-CTRLg1
Plasmid#139450PurposeLentiviral vector with non-targeting gRNA and neomycin selectable markerDepositorInsertNon-targeting sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only