We narrowed to 10,073 results for: CAG
-
Plasmid#61173PurposeFluorescent reporter for Golgi apparatus GmMAN49-mCherry expressed under MtBCP1 promoterDepositorInsertGmMAN49-mCherry
ExpressionPlantPromoterMtBCP1Available sinceApril 9, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiCRISPR v2 PC sg1
Plasmid#258098PurposeKnockoutDepositorAvailable sinceAug. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-mCherry-sgPHIP2
Plasmid#259662PurposeAll-in-one lentiviral vector designed to deliver and express both Cas9 nuclease and sgRNA targeting PHIP (sgPHIP2), with added feature for monitoring (expression of mCherry)DepositorAvailable sinceJuly 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pXPR_050_RIOK1-3
Plasmid#258253PurposeLentiviral expression of CRISPRi RIOK1 sgRNA #3DepositorAvailable sinceJuly 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hNC-gRNA2
Plasmid#249201PurposesgRNA controlDepositorInsertNon-Targeting
UseCRISPR and LentiviralPromoterU6Available sinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_14
Plasmid#239257Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorInsertsgRNA_14 targeting HK2 (HK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
Setd1a gRNA#3
Plasmid#235252PurposeCas9-mediated knockout of Setd1a in mammalian cellsDepositorAvailable sinceJan. 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-sgRXRa4-1; EF1a-mScarlet
Plasmid#242889PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarletDepositorInsertsgRNA targeting Rxra
UseCRISPR and LentiviralTagsmScarletExpressionMammalianPromoterU6Available sinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 R0+R1+R3 +SV40 base prom-GFP-IRES-AP
Plasmid#225892PurposeEnhancer reporterDepositorInsertR0+R1+R3
TagsEGFPExpressionMammalianAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCfb13198
Plasmid#219873PurposeThe base plasmid of TUNEYALI forTF08DepositorInsertContains gRNA targeting TF08 ( YALI1_D33640g) and homologous arm matching TF08
ExpressionYeastAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA047_Podxl
Plasmid#232932PurposeExpression vector for a sgRNA against the mouse Podxl locus and SpCas9 with T2A-Puromycin resistance gene.DepositorPublicationInsertCas9-T2A-PuroR (Podxl S. pyogenes)
ExpressionMammalianAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL518
Plasmid#231160PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE771
Plasmid#231159PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE485
Plasmid#231158PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable sinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgABCC4_1
Plasmid#217433PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human ABCC4DepositorInsertsgRNA 1 targeting ABCC4 (ABCC4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 spike G13 mutant
Plasmid#231915PurposeFor expression of SARS-CoV-2 spike protein with glycan deletion at N1098, N1158 by implementing Asn-to-Gln mutationDepositorAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only