We narrowed to 42,209 results for: Tro;
-
Plasmid#236235PurposeAAV expression of human STIM2 internally tagged with HaloTagDepositorInsertHaloTag-STIM2 (STIM2 Human)
UseAAVTagsHaloTag in position 29ExpressionMutationSignal peptide from STIM1 and residues 15-746 of …Promoterhuman Synapsin 1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
EW368 CMV-TO-UtroUpZF-deImmunLink-NZF(FLP-IN)
Plasmid#236154PurposePlasmid encoding the UtroUp zinc finger array attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertUtroUpZF-deImmunLink-NZF
UseTagsExpressionMammalianMutationPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta mouse
Plasmid#224577PurposeNegative Control for downregulation of the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta mouse (Dgkz Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa mouse
Plasmid#224576PurposeNegative Control for downregulation of the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa mouse (Dgka Mouse)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorInsertsh RNAi Diacylglycerol kinase zeta human (GTPBP6 Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorInsertsh RNAi Diacylglycerol kinase alfa human (DGKA Human)
UseRNAi and RetroviralTagsExpressionMutationPromoterH1Available SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2085-WT-GPA-NLuc-Biosensor-Retrovirus-TD135
Plasmid#222875PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(WT)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianMutationPromoterMSCV LTRAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNAintron-CHIKV-Structural polyprotein with Nluc tagged E2
Plasmid#215699PurposeProduces the Chikungunya virus structural polyprotein Capsid-E3-NLucE2-6K-E1DepositorInsertCHIKV structural polyprotein Capsid-E3-NLucE2-6K-E1
UseTagsExpressionMammalianMutationPromoterCMVAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-GMIP P363D P364D P366D
Plasmid#221323PurposeDox-inducible expression of GMIP mutant in mammalian cells by retroviral transductionDepositorInsertGMIP (Gmip Mouse)
UseRetroviralTags3xFLAGExpressionMutationP363D P364D P366DPromoterTRE3GAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TRE3G-IRSp53-T2A-Rac1(G12V)
Plasmid#221330PurposeDox-inducible expression of FLAG-IRSp53-T2A-HA-Rac1 G12V in mammalian cells by retroviral transductionDepositorUseRetroviralTagsExpressionMutationG12VPromoterTRE3GAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-TetOne-Puro-p62 K7A/D69A
Plasmid#204549PurposeExpresses p62 K7A/D69A in a doxycycline-dependent manner in mammalian cellsDepositorAvailable SinceAug. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
SVA-lncRNA AK057321 shRNA 1A scramble control
Plasmid#202835PurposeLentiviral vector that expresses a scrambled control shRNA for SVA-lncRNA AK057321 shRNA 1ADepositorInsertpLVX-SVA-lncRNA shRNA 1A scramble control
UseLentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVTagsExpressionMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 RFP i670
Plasmid#155345PurposeLentiviral expression of humnan CIT shRNA, RFP i670 expression, based on Addgene 12247DepositorAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-21a-GFP-Patronin CC 534–868
Plasmid#59054Purposefor E. coli expression of Patronin CC truncationDepositorAvailable SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-MAVS-M1A,M142A-invitro(KaganE14)
Plasmid#52018PurposeUsed for in vitro expression of the human MAVS CDS containing the point mutations M1A,M142ADepositorInsertMAVS-M1A,M142A
UseTagsExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaPromoterAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DjCas13d-pA/EF1a-mCherry-WPRE-pa
Plasmid#233033PurposeTo Express HA tagged DjCas13d the CMV promoter. Also encodes a mCherry gene outside of the viral genomeDepositorInsertDjCas13d and mCherry
UseAAVTagsmCherryExpressionMutationPromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MelanoTag-Control-PURO (pLJC5-GPR143-mScarlet-1xMyc)
Plasmid#160368PurposeStable expression of GPR143-mScarlet-1xMyc fusion protein for use as a control with MelanoTag-PURODepositorAvailable SinceNov. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV intron renilla TRICK CTE polyA
Plasmid#84443PurposeTRICK reporter mRNADepositorInsertRenill-TRICK
UseLuciferase; FrtTagsExpressionMammalianMutationPromoterTet-CMVAvailable SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-3XFLAG-renilla-luciferase-beta-globin-control
Plasmid#184393PurposeTransient transfection plasmid expressing Renilla-luciferase-beta-globin fusion proteinDepositorInsertRenilla luciferase
UseTags3X FLAGExpressionMammalianMutationPromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only