We narrowed to 895 results for: gcat
-
Plasmid#75906Purpose3rd generation lentiviral gRNA plasmid targeting human C8orf44-SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-CASI-InteinC-SpRY C aa714-1368-U6-Camk2d sgRNA
Plasmid#209788PurposeExpresses SpRY cas9C by the constitutive CASI promoter and sgRNA targeting the oxidative activation sites of Camk2d by U6 promoterDepositorInsertSpRY C, Camk2d sgRNA
UseAAVPromoterCASIAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(ETV4_5-2)-PGKpuroBFP-W
Plasmid#211961PurposeExpress gRNA against ETV4 with puro and BFPDepositorInsertsgRNA targeting ETV4 (ETV4 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA[bTub+DsxF].1046A
Plasmid#112694Purposeexpress two gRNA targeting bTub & DsxF under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[DsxF] (dsx Fly)
UseCRISPRAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CASK gRNA (BRDN0001149003)
Plasmid#77404Purpose3rd generation lentiviral gRNA plasmid targeting human CASKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST-ITGB1-V1
Plasmid#215454PurposeExpression vector with integrin beta1 tagged with the BiFC V1 fragmentDepositorInsertITGB1 (ITGB1 Human)
TagsVenus fragment 1 (V1)ExpressionMammalianMutationSilent mutations added to disrupt shRNA binding a…PromoterCMVAvailable SinceNov. 3, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR221-ITGB1(no stop)
Plasmid#215453PurposeGateway entry vector with integrin beta1 wild-type (WT) without a stop codonDepositorInsertITGB1 (ITGB1 Human)
UseGateway CloningMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceSept. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR2b-ITGB1(WT)
Plasmid#215450PurposeGateway entry vector with integrin beta1 wild-type (WT)DepositorInsertITGB1 (ITGB1 Human)
UseGateway CloningMutationSilent mutations added to disrupt shRNA binding a…PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pk335-CARGO-11mer-35kb-DSF-1-11
Plasmid#227489Purpose11-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK zeta human
Plasmid#224579PurposeTo stably downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(TRIM24_5-4)-PGKpuroBFP-W
Plasmid#211989PurposeExpress gRNA against TRIM24 with puro and BFPDepositorInsertsgRNA targeting TRIM24 (TRIM24 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs7732130-guide4
Plasmid#125447PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs7732130 (ZBED3 GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR rs11257655-guide3
Plasmid#118202PurposeCRISPR-mediated repression of human islet enhancer containing T2D-associated variant rs11257655 (CDC123/CAMK1D GWAS locus)DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001146911)
Plasmid#77689Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AK9 gRNA (BRDN0001147860)
Plasmid#77692Purpose3rd generation lentiviral gRNA plasmid targeting human AK9DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CALM1 gRNA (BRDN0001145447)
Plasmid#75761Purpose3rd generation lentiviral gRNA plasmid targeting human CALM1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1 gRNA (BRDN0001146284)
Plasmid#75539Purpose3rd generation lentiviral gRNA plasmid targeting human NME1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only