We narrowed to 16,665 results for: grn
-
Plasmid#231165PurposeT-DNA encoding gRNA targeting SlPDSDepositorInsertgRNA targeting SlPDS
ExpressionPlantPromoterAtU6Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL562
Plasmid#231162PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlCHL1DepositorInsertmobile gRNA targeting SlCHL1
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEE834
Plasmid#231168PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlPDSDepositorInsertmobile gRNA targeting SlPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-L101_guide-CBh-hSpCas9
Plasmid#188547PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p204-U6-Switch-ON
Plasmid#217883PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgLMNA
Plasmid#170546PurposeExpresses a sgRNA for 5' tagging to LMNA and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of LMNA
UseCRISPR and LentiviralAvailable SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-A
Plasmid#207823PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-NS-B
Plasmid#207824PurposeDual expression of Cas9 and non-specific sgRNADepositorInsertnon-specific sgRNA
UseCRISPR and LentiviralTagsFLAGPromoterEF-1a; U6Available SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pML45
Plasmid#206995PurposeContains gRNA targeting mouse Ptbp1 gene and Cas9 ORF.DepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.176
Plasmid#184997PurposeExpress -Eco1 RNF2 editing ncRNA and gRNADepositorInsertEco1: RNF2 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationRNF2 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW045
Plasmid#185690PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNAs
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW037
Plasmid#185688PurposeT-DNA for creating transgenic plants expressing Cas9 and Drm1b gRNAsDepositorInsertCas9, Drm1b gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only