We narrowed to 13,910 results for: IGH@
-
Plasmid#52011PurposeExpresses the human MAVS CDS containing the point mutations M1A and M142ADepositorInsertMAVS-M1A,M142A
UseRetroviralExpressionMammalianMutationchanged Met 1 to Ala and Met 142 to AlaAvailable SinceMarch 24, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-EFS-hfCas13d-T2A-mCherry-pA
Plasmid#192497PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGgaatacattaccaacGTGGTGtacGTGPromoterEFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-QQN
Plasmid#193563PurposeExpresses human Clathrin Light Chain B mutant (residues 20-22 were substituted from EED to QQN) tagged with mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationChanged from EED to QQN at residue 20-22PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(5)
Plasmid#193573PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 5 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(6)
Plasmid#193574PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 6 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(7)
Plasmid#193575PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a rigid alpha helix of 7 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-CLC-SNAP
Plasmid#193580PurposeExpresses human Clathrin Light Chain B tagged with SNAP-tag and mEGFP in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsSNAP-tag and mEGFPExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E9S7M7
Plasmid#103106PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE9S7M7(Cas9 coding gene from Ruminococcus albus 8)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M1C448Y
Plasmid#89326PurposeInducible expression of M1C448Y spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, C448YPromoterTet-responsive P tightAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET12a-AL-09 Y96F
Plasmid#47085DepositorAvailable SinceAug. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET12a-AL-09 Y91F
Plasmid#47084DepositorAvailable SinceAug. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET12a-AL-09 Y32F
Plasmid#47082DepositorAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTL51_cHS4-CAG-s36GFPHaloTag-IRES-PuroR-p2AmCherry3NLS-polyA-cHS4
Plasmid#223542PurposePUFFHalo cassette with s36GFP-HaloTag and mCherry-3NLS, strong constitutive promoter CAG, insulated by cHS4 for random integration, puromycin resistance for selection in mammalian cellsDepositorInserts36GFP-HaloTag, mCherry-3NLS, PAC
ExpressionMammalianPromoterCAGAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(flex5)
Plasmid#193576PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a flexible linker of 5 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(flex6)
Plasmid#193577PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a flexible linker of 6 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
CLC-EGFP206(flex7)
Plasmid#193578PurposeExpresses human Clathrin Light Chain B tagged with mEGFP at amino acid position 206 with a flexible linker of 7 amino acids in mammalian cells.DepositorInsertClathrin light chain B (CLTB Human)
TagsmEGFPExpressionMammalianMutationDeleted amino acids 207-211PromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-SQSfl
Plasmid#171010PurposeHiLITR protease with full-length SQS targeting information (ER)DepositorInsertEGFP-uTEV1-SQS(FL)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-DDRGK1-K227R-HA
Plasmid#139859PurposeLentiviral expression of human DDRGK1-K227R-HADepositorAvailable SinceMay 8, 2020AvailabilityAcademic Institutions and Nonprofits only