We narrowed to 910 results for: polya
-
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAct-FRT-FRT3-stop-FRT-LexGAD-FRT3-Gal4 attB
Plasmid#52890Purpose"CoinFLP-LexGAD/Gal4" - Expresses LexGAD or Gal4 from actin promoter downsteam of transcriptional stop. Recombination by FLP excises FRT-FRT pair to express LexGAD, or FRT3-FRT3 pair to express Gal4.DepositorInsertsExpressionInsectAvailable SinceJan. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEM BirA-2A-Citrine-SV40pA-FRT-Kan-FRT
Plasmid#89890PurposeBAC donor construct containing 3XHA-tagged BirA, a ribosome skipping motif - 2A, Citrine reporter, polyadenyation signal, followed by FRT recombination sites flanking kanamycin selection cassette.DepositorInsertHA-BirA-2A-citrine
UseUnspecifiedTagsCitrineAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
p35S_GFP-EVDinter-GUS
Plasmid#167123PurposePlant binary expression vector containing the intron and proximal polyadenylation signal sequences of the Copia93 retroelement EVADE (AT5G17125) between mGFP5 and GUS under CaMV 35S promoter.DepositorInsertEVADE GAG intron and terminator (EVD_in/ter) (AT5G17125 Mustard Weed)
TagsGUS and mGFP5ExpressionPlantPromoterCaMV 35SAvailable SinceApril 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAB2076 pAAV REPAIR.t1
Plasmid#176323PurposepAAV EFS-HIVNES-dCas13bt1- (GGS)2-huADAR2(E488Q)-3xHA BGHpolyA::U6-BpiI-Cas13bt1 DR (full REPAIR.t1 + crRNA expression for AAV production)DepositorInsertshuman codon optimized Cas13bt1 (catalytically inactivated)
huADAR2dd(E488Q) (ADARB1 Human)
Cas13bt1 crRNA + BpiI cloning site
UseAAV and CRISPRTags3xHA and HIV NESExpressionMammalianMutationE488Q, only the deaminase domain (aa 276-702 are …PromoterEFS (short EF1alpha) and hU6Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12VWPRE
Plasmid#129420PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusionDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Human, Entacmaea quadricolor (TagBFP))
UseMosaic analysis for dual recombinase-mediated cas…TagsTagBFP2-V5 tagMutationG12VPromoternone (3x polyA to mitigate episomal expression)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE
Plasmid#131730PurposeMADR donor plasmid for FlpO+Cre-mediated insertion of oncogenic Hras G12V with a TagBFP2 fusion compatible with RCE:loxP mouse strainDepositorInsertTagBFP2-V5-HRAS G12V (HRAS Human, Entacmaea quadricolor (TagBFP))
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsTagBFP2-V5 tagExpressionMammalianMutationG12VPromoternone (4x polyA to mitigate episomal expression)Available SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
MXS Chaining Kit
Plasmid Kit#1000000064PurposeMXS-chaining system for assembly of constructs optimized for synthetic biology applications in mammalian systems. 14 different fluorescent proteins, 10 mammalian promoters/enhancers, 3 polyA signalsDepositorAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
FNL Combinatorial Cloning Platform
Plasmid Kit#1000000211PurposeA collection of Multisite Gateway Entry clone plasmids which can be used in a combinatorial fashion to generate large numbers of tagged expression clones for protein expression in a variety of systemsDepositorAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
EMMA toolkit
Plasmid Kit#1000000119PurposeUsed for the construction of a variety of mammalian expression vectors in a one-pot, one-step Golden Gate reaction; compatible with automated productionDepositorAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only