We narrowed to 28,399 results for: CAT
-
Viral Prep#179459-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE (#179459). In addition to the viral particles, you will also receive purified pAAV-EF1a-DIO-JEDI-2P-Kv-WPRE plasmid DNA. EF1a-driven, Cre-dependent soma and AIS-localized expression of voltage indicator JEDI-2P. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagscEGFP (Cre-dependent)Available SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-EF1a-iCreV (AAV PHP.eB)
Viral Prep#140135-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-EF1a-iCreV (#140135). In addition to the viral particles, you will also receive purified pAAV-EF1a-iCreV plasmid DNA. EF1a-driven, light-inducible iCreV recombinase for spatiotemporally precise optogenomic modifications. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9
Plasmid#167547PurposeUsed for CRISPR-Cas9 mediated recombineering in Enterococcus. Can clone desired gRNA using BsaI digestion.DepositorInsertschloramphenicol acetyl transferase
pUC19 origin of replication
UseCRISPRExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pet28a-ClbB-NRPS-NHis
Plasmid#49217PurposeNRPS module of ClbB containing CAT domains with N-terminal 6His tagDepositorInsertClbB-NRPS
Tags6x His tag and T7 tagExpressionBacterialMutationcontains aa4-1080 of reference sequence NP_754362…PromoterT7Available SinceMarch 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIOM17
Plasmid#20870DepositorInsertaphA::cat
ExpressionBacterialAvailable SinceJuly 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TB
Plasmid#48650PurposeBacterial SP crRNA expression: targets SP to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL5
Plasmid#72989PurposeRBS_M2DepositorInsertM2 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL11
Plasmid#72995PurposeRBS_L4DepositorInsertL4 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL4
Plasmid#72988PurposeRBS_H5DepositorInsertH5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL8
Plasmid#72992PurposeRBS_L1DepositorInsertL1 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-L1U1H09
Plasmid#73008PurposeL1U1H09 terminatorDepositorInsertL1U1H09 terminator
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TB
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL6
Plasmid#72990PurposeRBS_M3DepositorInsertM3 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBP-TL7
Plasmid#72991PurposeRBS_M5DepositorInsertM5 RBS
UseSynthetic BiologyMutationCAT gene - C435G (nucleotide) - silent mutagenesi…Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only