We narrowed to 9,373 results for: Pol;
-
Plasmid#179225Purposeoverexpression in human cellsDepositorAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only
-
p23-mNeongreen-DDX21 WT
Plasmid#179228Purposeoverexpression in human cellsDepositorAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_6_002
Plasmid#167348PurposeddPCR gating control for droplets containing either gag+5'pol targets OR 3'pol+tat targetsDepositorInsertpol_gag_tat
UseOtherAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_29_006
Plasmid#167352PurposeddPCR gating control for droplets containing either env+5'pol targets OR env+3'pol targetsDepositorInsertpol_env
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
p23-mRuby3-DDX21 WT
Plasmid#179231Purposeoverexpression in human cellsDepositorAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 DAT-mRuby3
Plasmid#179226Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreen and mRuby3ExpressionMammalianMutationG234D, K235APromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 HGV-mRuby3
Plasmid#179227Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreen and mRuby3ExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
PGEX-DDX21-D2+C
Plasmid#179243Purposeprotein purification in E. coliDepositorAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 HGV
Plasmid#179230Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreenExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-mNeongreen-DDX21 DAT
Plasmid#179229Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmNeongreenExpressionMammalianMutationG234D, K235APromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA E45A
Plasmid#217438PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with E45A mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA E45AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q63/67A
Plasmid#217439PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q63A,Q67A mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q63A,Q67AAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA M66I
Plasmid#217440PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef; contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with M66I mutation in CA).DepositorInsertgag/pol
UseLentiviralMutationCA M66IAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
HIV-1-GFP ΔEnv CA Q67H/N74D
Plasmid#217441PurposeHIV-1 reporter vector that is env-deficient and expresses eGFP in place of nef. Contains 5' and 3' LTRs, gag, pol, tat, and rev, but does not express vif, vpr, or vpu (with Q67H,N74D mutations in CA).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
p23-mRuby3-DDX21 HGV
Plasmid#179233Purposeoverexpression in human cellsDepositorInsertDDX21 (DDX21 Human)
TagsmRuby3ExpressionMammalianMutationD338H, E339GPromoterEF-1alphaAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Sc [Pri1 + Pri2]-pRS403/GAL
Plasmid#241977PurposeOver-express Sc Pri1 & Pri2 (Sc pol alpha subunits) in yeast (integrated)DepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-rad30-pRS403/GAL
Plasmid#241260PurposeOver-express Sc FLAG-rad30 (Sc Pol eta) in yeast (integrated)DepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc rev3-FLAG-pRS402/GAL
Plasmid#241258PurposeOver-express Sc rev3-FLAG (Sc Pol zeta subunit) in yeast (integrated)DepositorAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Ec holD-pET(3c)
Plasmid#237236Purposeover-express E. coli holD (Pol III psi subunit)DepositorInsertholD (psi) (holD E. coli)
ExpressionBacterialAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only