We narrowed to 18,380 results for: bon;
-
Plasmid#244978PurposeExpress JIP4 in mammalian cells with mBaoJin tag (monomeric StayGold)DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only
-
mCherry-RILPL1 (R293A)
Plasmid#244981PurposeExpress RILPL1 in mammalian cells with mCherry tag expressing a R293A mutationDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEMS2001
Plasmid#105871PurposeHigh copy HRPT backbone plasmid for insertion of MiniP promotersDepositorTypeEmpty backboneAvailable SinceFeb. 22, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJK048
Plasmid#75230PurposeProduces Escherichia coli N5-carboxyaminoimidazole ribonucleotide mutase (EcPurE1-H45W) and N5-carboxyaminoimidazole ribonucleotide synthetase (EcPurK)DepositorInsertsN5-carboxyaminoimidazole ribonucleotide mutase
N5-carboxyaminoimidazole ribonucleotide synthetase
ExpressionBacterialMutationPro64 to Arg; Asp65 to His; Gln206 to Arg and cha…PromoterT7 and n/aAvailabilityAcademic Institutions and Nonprofits only -
phCMV-coGALVenv-C4070A
Plasmid#172217PurposeExpresses the envelope protein of Gibbon Ape Leukemia Virus (GALV) for pseudotyping of retroviral or lentiviral vectorsDepositorInsertEnvelope protein of Gibbon Ape Leukemia Virus (codon-optimized version)
ExpressionMammalianMutationCarries C-terminus of amphotropic MLV strain 4070…PromoterCMV immediate early promoterAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
SUPERBLADE5
Plasmid#134913PurposeEmpty backbone for cloning sgRNA sequence to be used in nanoblades system (Optimized for increased genome editing efficiency via Chen B et al., 2013)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyPromoterU6Available SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pINTO-NFH::hSNRNP70
Plasmid#65926PurposeExpression of human SNRNP70 fused to Flag-HA tag (N-terminus)DepositorInsertsmall nuclear ribonucleoprotein 70kDa (U1) (SNRNP70 Human)
TagsFLAG-HAExpressionMammalianMutationTwo silent mutationsPromoterCMV/TO and CMV/TetO2 (T-REx)Available SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEA01
Plasmid#170766PurposeUtilisation of pSAM2 excision tool in Amycolatopsis sppDepositorInsertsxis, int
oriT
pac
ExpressionBacterialPromotertrcpAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only