We narrowed to 1,028 results for: Psp
-
Plasmid#226203PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator megaplasmid copy of the CBB operon (deltaCBBp).DepositorInsertHomology arms for megaplasmid copy of the CBB operonthe CBB operon (deltaCBBp).
UseSynthetic BiologyTagsExpressionMutation∆cbbR ∆cbbLpSpXpYpEpFpPpTpZpGpKpApPromoterAvailable SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCPH2A.X_K5Q-GS3
Plasmid#204746PurposeExpression of Cas9 and human H2AX with the K5Q mutationDepositorInsertH2AX K5Q (H2AX Human)
UseTagsExpressionMammalianMutationH2AX with the K5Q mutationPromoterAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K5R-GS3
Plasmid#204747PurposeExpression of Cas9 and human H2AX with the K5R mutationDepositorInsertH2AX K5R (H2AX Human)
UseTagsExpressionMammalianMutationH2AX with the K5R mutationPromoterAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K134L-GS3
Plasmid#204750PurposeExpression of Cas9 and human H2AX with the K134L mutationDepositorInsertH2AX K134L (H2AX Human)
UseTagsExpressionMammalianMutationH2AX with the K134L mutationPromoterAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K134M-GS3
Plasmid#204751PurposeExpression of Cas9 and human H2AX with the K134M mutationDepositorInsertH2AX K134M (H2AX Human)
UseTagsExpressionMammalianMutationH2AX with the K134M mutationPromoterAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPH2A.X_K134A-GS3
Plasmid#204752PurposeExpression of Cas9 and human H2AX with the K134A mutationDepositorInsertH2AX K134A (H2AX Human)
UseTagsExpressionMammalianMutationH2AX with the K134A mutationPromoterAvailable SinceJune 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-beta
Plasmid#88847PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-alpha
Plasmid#88846PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG462
Plasmid#100903PurposeSpCas9n (D10A Nickase mutant) with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
RBM14_pLX307
Plasmid#98367PurposeLentiviral expression of RBM14DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
ABEmax-Puro V3
Plasmid#226956PurposeABEmax plasmid enabling A:T to G:C base editing using a single plasmid. sgRNA uses 3TC scaffold for increased sgRNA expression.DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDG461
Plasmid#100902PurposeSpCas9n (D10A Nickase mutant) with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of DSBs with no off-target cuts.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-EGFPExpressionMammalianMutationD10A mutant converts to NickasePromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dCas13-inactive M3nls
Plasmid#157854PurposeTargeted m6A RNA methylation in mammalian cells, methyltransferase-inactive mutantDepositorInsertdCas13-inactive dCas13-inactive M3nls (METTL3 Cas13b is from Prevotella sp. P5-125; METTL3 is from H. sapiens)
UseTagsExpressionMammalianMutationPspCas13b Δ984-1090 H133A; METTL3 D395APromoterAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
AOI-WT-Cas9-sg-mouse Suz12-F1-GFP
Plasmid#91881PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only