We narrowed to 20,164 results for: BASE;
-
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A C-Term
Plasmid#69795PurposePebble isoform A, C-Term, in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble C-Term domain (Drosophila guanine nucleotide exchange factor)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutationJust the C-Term domain of Pebble (pbl)Promoterhsp70 promoterAvailable SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C820S (NT573)
Plasmid#49075PurposeExpresses human NKCC1 C820S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC820S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C1052S (NT674)
Plasmid#49076PurposeExpresses human NKCC1 C1052S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC1052S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C791S (NT572)
Plasmid#49074PurposeExpresses human NKCC1 C791S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC791S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 intracellular-cysteineless (NT855)
Plasmid#49080PurposeExpresses human NKCC1 mutant lacking cysteine residues within intracellular loops and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC791S, C820S, C1052S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 ECL4 deletion (NT865)
Plasmid#49070PurposeExpresses human NKCC1 truncation mutant lacking extracellular loop #4 (aa562-582) and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationECL4 deletion of amino acids 562-582 in hNKCC1 in…PromoterCMVAvailable SinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C543M (NT360)
Plasmid#49068PurposeExpresses human NKCC1 C543M mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC543M in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S,C724V (NT501)
Plasmid#49073PurposeExpresses human NKCC1 C723S and C724V mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC723S,C724V in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630S (NT400)
Plasmid#49072PurposeExpresses human NKCC1 C630S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC630S in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630A (NT399)
Plasmid#49071PurposeExpresses human NKCC1 C630A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC630A in hNKCC1 in NT17PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 cysteineless (NT868)
Plasmid#49079PurposeExpresses human NKCC1 mutant lacking cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C563S,C568S,C577S,C582S, C630S, C72…PromoterCMVAvailable SinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 TM-cysteineless (NT859)
Plasmid#49078PurposeExpresses human NKCC1 mutant lacking cysteine residues within transmembrane domains and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic,containing convenient restriction sitesDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Human, Synthetic)
Tags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C630S, C723S, C724V in hNKCC1 in NT…PromoterCMVAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only