We narrowed to 16,278 results for: nes
-
Plasmid#214526PurposeAiE2405m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1334 - pAAV-AiE2116m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214485PurposeAiE2116m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1420 - pAAV-AiE2112m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214491PurposeAiE2112m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1425 - pAAV-AiE2132m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214495PurposeAiE2132m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable sinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MLKG1delKASH
Plasmid#130842PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMLKG1
TagseGFP-FLAG-HAExpressionPlantMutationDeletion of KASH domainPromoterCaMV 35SAvailable sinceSept. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti-sgTnr#2/Cre
Plasmid#193245PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tnr geneDepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgApc#2/Cre
Plasmid#193202PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Apc geneDepositorAvailable sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgHcn1#2/Cre
Plasmid#193218PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Hcn1 geneDepositorAvailable sinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP221-AAV-RSV-GFP-pA
Plasmid#62919PurposeAAV vector backbone designed to express GFP from a RSV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoterRous Sarcoma Virus(RSV)Available sinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0006
Plasmid#178375PurposeExpresses KSHV K2 ORF taggedDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKSHV ORF K2
Tags3xFLAGExpressionMammalianAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOME0016
Plasmid#178386PurposeExpresses KSHV ORF45 taggedDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertKSHV ORF 45
Tags3xFLAGExpressionMammalianAvailable sinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
SUN2delSUN
Plasmid#130835PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertSUN2
TagsmCherry-FLAG-HAExpressionPlantMutationDeletion of SUN domainPromoterCaMV 35SAvailable sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pInducer10-UBC9-sh1
Plasmid#168986PurposeExpresses RFP cDNA and UBC9 shRNA 1 in mammalian cellsDepositorAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pF-01
Plasmid#166931PurposeGFP coding region part (F)DepositorInsertGreen Fluorescent Protein - Block F- Flanked by BsaI sites
UseSynthetic BiologyExpressionBacterialAvailable sinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTrichoGate-17
Plasmid#160717PurposeTrpC Terminator bordered by BsaI restriction sitesDepositorInserttryptophan synthase transcription terminator (TtrpC) bordered by BsaI restriction sites
UseSynthetic BiologyMutationIncorporation of BsaI restriction sitesAvailable sinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDF-NtXNtT5R1AtR2NtB2
Plasmid#160888PurposeExpression of N. tabacum Rubisco small subunit (rbcS-T5), Rubisco chaperone protiens rbcX, raf1, bsd2 and A. thaliana Rubisco chaperone proteins raf2 in E. coli.DepositorInsertPT7-Nt-rbcS-T5
ExpressionBacterialPromoterrbcS-T5: T7, chaperones: T11Available sinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPS0380
Plasmid#133230PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter Rlv3841pnifH (pOGG082), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable sinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
LI F-G Kan
Plasmid#104523PurposeLI resistance gene moduleDepositorInsertKanamycin resistance gene
UseCloning vectorAvailable sinceOct. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only