We narrowed to 13,244 results for: BASE
-
Plasmid#114226PurposePOC12364, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type c-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_dFq
Plasmid#114227PurposePOC12365, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type d-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXLC_eFq
Plasmid#114228PurposePOC12366, MetClo assembly vector with p15A replication origin and chloramphenicol resistance for BsaI-based MetClo, adaptor sequence type e-qDepositorInsertLacZalpha
UseSynthetic BiologyAvailable SinceFeb. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHES945
Plasmid#112643Purposeblue light inducible cryptochrome based optogenetic expression systemDepositorInsertCRY2PHR-GAL4DBD
ExpressionYeastPromoterTDH3Available SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
piHGpd/G170D
Plasmid#1328DepositorAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pGP-pcDNA3.1 Puro-CAG-Voltron2-ST
Plasmid#172910PurposeMammalian expression of voltage sensor; soma localization targeting sequenceDepositorInsertVoltron2-ST
Tagssoma localization targeting sequenceExpressionMammalianMutationA122DPromoterCAGAvailable SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-TRPM7
Plasmid#23476DepositorInsertTRPM7 (TRPM7 Human)
UseGateway donor vectorMutationInsert encodes NCBI: NR_149154.2 bases 265 to 146…Available SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGP-CAG-VARNAM A122D WPRE-bGH-polyA
Plasmid#180486PurposeMammalian expression of voltage sensorDepositorInsertVARNAM A122D
ExpressionMammalianMutationA122DPromoterCAGAvailable SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT2 NCmut-14-GFP11_SEPT2 NCmut-14-GFP10
Plasmid#180357Purposemammalian co-expression of human SEPT2 NCmut fused to GFP10 and of human SEPT2 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT2 F20D, V27DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i1 NCmut-14-GFP11_SEPT9_i1 NCmut-14-GFP10
Plasmid#180358Purposemammalian co-expression of human SEPT9_i1 NCmut fused to GFP10 and of human SEPT9_i1 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i1 I281D, M288DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pLenti-ACTA2-R179 (WT) (LLH661)
Plasmid#242682PurposePlasmid for expression of ACTA2-R179 (wild-type) cDNA from a lentiviral cassetteDepositorInsertpLenti-ACTA2-R179_cDNA
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB OROV Gc Spike H6
Plasmid#229662PurposeMake PiggyBac stable cell line expressing Oropouche virus BeAn 19991 Gc spike region (residues 482–894 of M polyprotein) with C-terminal His6 tagDepositorInsertOROV Gc spike
UsePiggybacTags6xHisExpressionMammalianMutationcontains residues 482-894 onlyPromoterTREAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_GFP10-14-SEPT7 Gmut1
Plasmid#180354Purposemammalian co-expression of human SEPT7 Gmut1 fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i1 Gmut-14-GFP10
Plasmid#180355Purposemammalian co-expression of human SEPT9_i1 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i1 W520A, H530DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_GFP11-14-SEPT7 Gmut1_SEPT9_i3 Gmut-14-GFP10
Plasmid#180356Purposemammalian co-expression of human SEPT9_i3 Gmut fused to GFP10 and of human SEPT7 Gmut1 fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT7 W269A, H279D and SEPT9_i3 W502A, H512DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIP TRE BI_SEPT9_i3 NCmut-14-GFP11_SEPT9_i3 NCmut-14-GFP10
Plasmid#180360Purposemammalian co-expression of human SEPT9_i3 NCmut fused to GFP10 and of human SEPT9_i3 NCmut fused to GFP11DepositorUseLentiviralTagsGFP10 and GFP11ExpressionMammalianMutationSEPT9_i3 I263D, M270DPromoterbidirectional TREAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(K35A/K68A/K72/PAMmut)
Plasmid#176140PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutations Lys35Ala, Lys68Ala, Lys72Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resisDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutations Lys35 to Ala, Lys6…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
Integrated Genomics Plasmids
Plasmid Kit#1000000004PurposePlasmids used in Integrated Genomics: A Discovery-Based Laboratory Course; please note that the C. elegans yeast two-hybrid cDNA library is unavailableDepositorAvailable SinceJuly 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
HC-M
Plasmid#173481PurposeAn rrnB P1-based GFP ATP reporter in E. coliDepositorInsertGFP-mut2
UseSynthetic BiologyTagsssrA degradation tagExpressionBacterialPromoterrrnB P1Available SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only