178,552 results
-
Plasmid#211509PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4-Phosphate (PI(4)P) from bacteriaDepositorInsertSidC (P4C)
Tags6xhis-SNAPExpressionBacterialAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(4,5)P2 Probe
Plasmid#211513PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4,5-Bisphosphate (PI(4,5)P2) from bacteriaDepositorInsertPLCdelta1-PH
Tags6xhis-SNAPExpressionBacterialAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gaq
Plasmid#196058PurposeEncodes a G alpha subunit (GNAQ) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable sinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Bxb1-LP-v2-TC
Plasmid#194326PurposeAAVS1 targeting construct with the Bxb1 landing pad version 2 cassette.DepositorInsertloxP-EBFP2-attP-BleoR-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_T2A_iRFP670 sgBFP
Plasmid#192478PurposeAll-in-one plasmid for cutting BFP region in DSB Spectrum V2 or V3DepositorInsertSpCas9
TagsT2A iRFP670ExpressionMammalianAvailable sinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_lox
Plasmid#183762PurposeBxb1-specific donor plasmid for the cloning of payloads <20 kbDepositorTypeEmpty backboneUseCre/Lox and Synthetic BiologyExpressionMammalianAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB025
Plasmid#183092PurposeExpresses FnCas12a in Bacteroides and used for genome editingDepositorInsertFnCas12a, gRNA, Promoter, HAB, TetR,
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1TDPGH023Available sinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Antibody#180082-rAbPurposeAnti-PSD-95 (Human) recombinant mouse monoclonal antibodyDepositorRecommended applicationsImmunohistochemistry and Western BlotReactivityHuman, Mouse, and RatSource speciesMouseIsotypeIgG2aTrial sizeAvailable to purchaseAvailable sinceMarch 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pDY0216 PASTEv1 PE2-P2A-Bxb1
Plasmid#179104PurposePASTEv1 PE2-P2A-Bxb1DepositorInsertpCMV-PE2-P2A-Bxb1
ExpressionMammalianAvailable sinceFeb. 19, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CAG-fDIO-mNeonGreen (AAV1)
Viral prep#99133-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-fDIO-mNeonGreen (#99133). In addition to the viral particles, you will also receive purified pAAV-CAG-fDIO-mNeonGreen plasmid DNA. CAG-driven, Flp-dependent mNeonGreen expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsmNeonGreen (Flp-dependent)Available sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-hSyn1-GFP
Plasmid#177810PurposeEncodes a GFP driven by human synapsin I promoterDepositorInsertCopGFP inserted behind human synapsin I promoter (SYN1 Human)
UseLentiviralExpressionMammalianPromoterSyn1Available sinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
mito-meGFP
Plasmid#172481PurposemeGFP targeted to the mitochondrial matrix with a human COX8 presequenceDepositorInsertMito
TagsmeGFPExpressionMammalianPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-S5E2-GCaMP6f (AAV PHP.eB)
Viral prep#135632-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-S5E2-GCaMP6f (#135632). In addition to the viral particles, you will also receive purified pAAV-S5E2-GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the E2 regulatory element. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-GFP
Plasmid#171993PurposeDelivers all prime editing nickase components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-MacroGreen
Plasmid#160665PurposeExpresses GFP fusion of a multisite mutant of the Af1521 proteinDepositorInsertAf1521 modified synthetic construct eGFP fusion
TagseGFP and hexahistidine_TEV recognitionExpressionBacterialPromoterLacIAvailable sinceJuly 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
SIN40C.SFFV.Luciferase.IRES.GFP
Plasmid#169308PurposeConstitutive overexpression of Luciferase cDNA with GFP as a reporter fluorescent proteinDepositorInsertLuciferase
UseLentiviralTagsIRES-EGFPPromoterSFFVAvailable sinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
4xHRE-MinTK-CRE-ODD
Plasmid#141147Purposelentiviral expression vector to generate a hypoxia fate-mapping systemDepositorInsert4xHRE-MinTK-CRE-ODD
UseLentiviralMutationcontains an altered Cre gene modified by the addi…Available sinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-Gαi*-BERKY3
Plasmid#158198PurposeBRET biosensor for detection of Gαi-GTP in mammalian expression vector pcDNA3.1(+)DepositorInsertLyn11-Nluc-ER/K linker-3xYFP-KB1753-myc
TagsmycExpressionMammalianPromoterCMVAvailable sinceSept. 17, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOlyA(WT)
Plasmid#132391PurposeOstreolysin A for sensing sphingomyelin/cholesterol complexesDepositorInsertOstreolysin A wild-type
TagsHis6 tagExpressionBacterialMutationMutations: C62S, C94S, S151CAvailable sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by