We narrowed to 27,806 results for: gfp
-
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
B108-GFP-IRES-AP
Plasmid#73988PurposeB108 enhancer of Blimp1 gene drives EGFP expression.DepositorInsertB108 enhancer
ExpressionMammalianAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA2
Plasmid#73982PurposeOtx2 shRNA2 (based on mir155) was inserted into the 3'UTR of EGFP.DepositorInsertEGFP-Otx2-shRNA2
UseRNAiExpressionMammalianPromoterCAGAvailable SinceMay 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL14-GFP
Plasmid#67406PurposeMammalian expression of hArl14 with C-term GFP tagDepositorInsertARL14 (ARL14 Human)
TagsGFPExpressionMammalianMutationbp 172 C to T; aa L58FPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
ZS007:eGFP-TM
Plasmid#186429PurposeeGFP-TMDepositorInserteGFP-TM
ExpressionMammalianPromotercmvAvailable SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-FLAG-GFP-Ubl4A-N(1-89)
Plasmid#86922PurposeTo express Ubl4A (1-89 residues) tagged with FLAG-EGFP at N- terminus.DepositorInsertUBL4A (UBL4A Human)
TagsFLAG and GFPExpressionMammalianMutationResidues from 90-157 is deletedPromoterCMVAvailable SinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pATZ-HA-GFP11
Plasmid#177720PurposeER protein alpha-1-antitrypsin containing E342K mutation (ATZ mutant) fused to an HA tag and the eleventh β-strand of GFPDepositorInsertalpha-1-antitrypsin (SERPINA1 Human)
TagsGFP11 and HAExpressionBacterial and MammalianMutationE342K (ATZ mutant)Available SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV MN (eGFP)
Plasmid#89932PurposeExpresses the MN fragment only of the sMTase system for targeted DNA methylation in mammalian cells. Contains a eGFP marker expressed off separate promoter.DepositorInsertMN
TagsHAExpressionMammalianMutationM.SssI residues 2-272 fragmentPromoterCMVAvailable SinceSept. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMXs-IP-PEX3-EGFP
Plasmid#228142PurposeExpresses PEX3-GFP in mammalian cellsDepositorAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK EGFP-RAB3A-WT
Plasmid#206146PurposePGK EGFP-RAB3A-WTDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FKBP-AP180-GFP
Plasmid#186577PurposeExpression of the fusion protein FKBP-AP180-GFP. Uses rat AP180 residues 328-896.DepositorAvailable SinceAug. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT p85-GFP
Plasmid#126660PurposeInducible expression of p85-GFP in S2 cellsDepositorInsertPI3K SH2 containing subunit
ExpressionInsectAvailable SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf GFP-vclb
Plasmid#185411PurposeGFP tagged form of zebrafish vinculin b. For in vitro transcription (SP6) or expression through CMVDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf GFP-vcla
Plasmid#185410PurposeGFP tagged form of zebrafish vinculin a. For in vitro transcription (SP6) or expression through CMVDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBK1340-LV-DUAL-dGFP-NanoLuc-Puro
Plasmid#223160PurposeExpression of destabilized GFP (dGFP) and NanoLuc for shortened in vivo half-lifeDepositorInsertdGFP-P2A-NanoLuc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EBFP2-P2A-EGFP
Plasmid#184938PurposeExpresses blue fluorescent protein EBFP2 and EGFP in mammalian cellsDepositorInsertEBFP2-P2A-EGFP
UseAAVExpressionMammalianPromoterCAGAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP-Puro-TetOn-L1RP-ORF1_StammerAAA_Halo-GFPai
Plasmid#202571PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the M91A, E92A, and L93A mutations and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorInsertLINE-1
TagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Methionine 91 to Alanine, ORF1p Glu…Available SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCEP-Puro-TetOn-L1RP-ORF1_K3AK4A_Halo-GFPai
Plasmid#202568PurposeExpresses an endogenous-like L1RP LINE-1 element with a C-terminal HaloTag on the ORF1 protein with the K3A and K4A mutations and a GFP retrotransposition reporter (GFP-AI) in the 3' UTRDepositorInsertLINE-1
TagsGFP-AI retrotransposition reporter and HaloTag7 o…ExpressionMammalianMutationChanged ORF1p Lysine 3 to Alanine, ORF1p Lysine 4…Available SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cx26-msfGFP
Plasmid#69016PurposeExpresses rat Cx26 (Gjb2 CDS) with a 7 amino acid linker on the C-terminus of the Connexin linking to monomerized superfolder Green Fluorescent Protein. Expression driven by CMV promoter.DepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only