We narrowed to 16,111 results for: NOL
-
Plasmid#124251PurposeIn vitro transcription plasmid for T7 transcription of Her2 ITD sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing Her2 sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV128
Plasmid#124252PurposeIn vitro transcription plasmid for T7 transcription of KRAS WT sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJV129
Plasmid#124253PurposeIn vitro transcription plasmid for T7 transcription of KRAS G12V sequence targeted to the endosome. Linearize with SapI.DepositorInsertMinigene containing KRAS sequences fused to endosomal targeting sequence of class I MHC
UseIn vitro transcription templatePromoterT7Available SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-nCas9
Plasmid#163538PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)eA3A T31AAvailable SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_UdgX-EE-UdgX-nCas9
Plasmid#163564PurposeMammalian CG-to-GC base editingDepositorInsertUdgX-EE-UdgX-nCas9
UseCRISPRExpressionMammalianMutationnCas9 (D10A)EE (R126E, R132E)Available SinceDec. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-RNF169UBD
Plasmid#119009PurposeMammalian expression of a fusion protein of human BRCA1 with the human RNF169 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-BRCA1-Rad18UBD
Plasmid#119008PurposeMammalian expression of a fusion protein of human BRCA1 with human Rad18 Ubiquitin binding domain and BFP expressionDepositorAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_As
Plasmid#155057PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_As
Plasmid#155058PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_As
Plasmid#155056PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_1_As
Plasmid#155055PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon2_2_Lb
Plasmid#155052PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 2 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 2
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBOB-N-Flag-Snrnp40
Plasmid#134249PurposeLentivector encoding Flag-tagged Snrnp40DepositorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Met133I, M1381I, M186I ELL2
Plasmid#127263PurposeFor in vitro translation of human ELL2 with Met133I, M1381I, M186IDepositorInsertELL2 (Met133ILeu, M1381ILeu, M186ILeu) (ELL2 Human)
UseIn vitro translationMutationThree Mets (133, 138, 186) to IleuPromoterT7Available SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
563aa ELL2 pEF4B
Plasmid#127273PurposeExpresses 563aa human WT ELL2DepositorInsertELL2 truncated at SphI (ELL2 Human)
ExpressionMammalianMutationContains 564 N-terminal amino acids ELL2, termina…PromoterpEF1aAvailable SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKdH_P-GAP-ScACS1*
Plasmid#126736Purposeyeast plasmid overexpressing ACS1 from Saccharomyces cerevisiaeDepositorInsertacs1*
Tags6xHis,MycExpressionYeastMutationT3542C and A30S, P113S, and S629N (please see dep…PromoterGAPAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKdH_P-GAP-ScADH2+P-GAP*-ScACS1*
Plasmid#126738Purposeyeast plasmid overexpressing ADH2 and ACS1 from Saccharomyces cerevisiaeDepositorInsertadh2,acs1*
Tags6xHis,MycExpressionYeastMutationT3542CPromoterGAPAvailable SinceJuly 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged Sph ELL2
Plasmid#127270PurposeFor in vitro translation of human WT ELL2 with internal HA tagDepositorInsertELL2 (ELL2 Human)
UseIn vitro translationMutationWT Mets and HA tag at SphI site (8th Met)PromoterT7Available SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA tagged mid ELL2
Plasmid#127274PurposeExpresses human ELL2 with HA tag in the middle that does not disrupt functionDepositorInsertELL2 with HA at XbaI (ELL2 Human)
ExpressionMammalianMutationHA inserted at XbaI after Met 186PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only