We narrowed to 19,702 results for: CAL
-
Plasmid#91366PurposeProtein expression and purification of human SH3 domain construct SH3RF1-3/4DepositorInsertSH3RF1-3/4 (SH3RF1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_ARHGEF26-1/1
Plasmid#91342PurposeProtein expression and purification of human SH3 domain construct ARHGEF26-1/1DepositorInsertARHGEF26-1/1 (ARHGEF26 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_MAP3K9-1/2
Plasmid#91313PurposeProtein expression and purification of human SH3 domain construct MAP3K9-1/2DepositorInsertMAP3K9-1/2 (MAP3K9 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_SH3RF3-1/2
Plasmid#91280PurposeProtein expression and purification of human SH3 domain construct SH3RF3-1/2DepositorInsertSH3RF3-1/2 (SH3RF3 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pISH-Emx1-SR
Plasmid#105214Purposeto generate a riboprobe for in situ hybridazationDepositorInsertEmx1 (Emx1 Mouse)
UseTo ganerate riboprobeAvailable SinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN269
Plasmid#91632PurposeExpress sgRNA targeting human KCNB1DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN064
Plasmid#91597PurposeExpress sgRNA targeting human DGKIDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN065
Plasmid#91598PurposeExpress sgRNA targeting human DGKIDepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20cdc8-cerulean3
Plasmid#99358PurposeBacterial expression of Cerulean3 fused to the 3' of cDNA of the fission yeast tropomyosin, cdc8.DepositorAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJC20Cerulean3-Cdc8
Plasmid#99357PurposeBacterial expression of Cerulean3 fused to the 5' of cDNA of the fission yeast tropomyosin, cdc8.DepositorAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM5089
Plasmid#85125PurposeKaiB expressed from native promoter from NSII-Nt. Complements rhythms of kaiB null strain.DepositorInsertPkaiB-kaiB
ExpressionBacterialAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL1632
Plasmid#62829PurposeLim Lab plasmid: AmpR + PLlacO-1::RBS(st7) gfp::Asp terminator + ColE1DepositorInsertgfp
UseSynthetic BiologyTagsst7 RBSExpressionBacterialPromoterpLlacO-1Available SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGex2t SadBs
Plasmid#66882PurposeBacterial expression vector encoding N-terminally GST-tagged short isoform of human SadBDepositorAvailable SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-gfaABC1D-mCherry-CAAX
Plasmid#250168PurposeAAV mediated overexpression of membrane targeted mCherryDepositorInsertmCherry-CAAX
ExpressionMammalianPromotergfaABC1DAvailable SinceMarch 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
pFUW LAMP1Sig-mEmerald
Plasmid#239555PurposeExpression and lysosomal localization of mEmeraldDepositorArticleInsertmEmerald
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_NES-Kinprola_PKA-mEGFP_WRPE-SV40
Plasmid#233366PurposehSyn1 driven expression of the PKA activity recorder Kinprola_PKA fused to mEGFP for neuronal expression through AAV transductionDepositorInsertNES-Kinprola_PKA-mEGFP
UseAAVTagsNES and mEGFPPromoterhSyn1Available SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRBV27
Plasmid#237947PurposeEncodes TRBV27 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRBV2
Plasmid#237903PurposeEncodes TRBV2 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP14924 - pAAV-AiE0675m-minBG-iCre(297T)-BGHpA
Plasmid#233571PurposeAiE0675m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only