We narrowed to 16,423 results for: grn
-
Plasmid#101813PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G14-R0
Plasmid#101806PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRRNA-G10-R0
Plasmid#101804PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[S1Apt]
Plasmid#68425PurposeTransient expression in mammalian cells of an "INT" construct_bearing the "S1" streptavidin aptamer, targeting the GLuc reporter. U6 promoterDepositorInsertINT construct with S1 streptavidin aptamer
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI3M-TBD
Plasmid#113077PurposeExpresses enCas9 fused to PolI3M-TBD in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI3M-TBD
ExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2518
Plasmid#91075PurposeModule B, Promoter: TaU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning, Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning
UseCRISPRPromoterTaU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRia-v2
Plasmid#84832PurposeCRISPRi/a V2 library parental plasmidDepositorInsertssgRNA
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_AAVS1_T2
Plasmid#79888PurposeExpresses the AAVS1 T2 gRNA in combination with FLAGless eSpCas9(1.1) to target the AAVS1 "safe harbor" locus.DepositorTypeEmpty backboneUseCRISPRTagsUntagged eSpCas9(1.1)ExpressionMammalianPromoterCBhAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiV_Cas9_Blast
Plasmid#125592PurposeLentiviral expression of spCas9 with blasticidin resistance geneDepositorInsertCas9
UseCRISPR and LentiviralTagsFLAGExpressionMammalianPromoterEFS promoterAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
iMAP-61
Plasmid#187460PurposegRNA array of iMAP-61DepositorInsertsgRNA array
UsePiggybacExpressionMammalianPromotermodified U6Available SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDAS12489_PEAR-GFP_2in1_2.0
Plasmid#177186PurposePEAR-GFP3 plasmid with a pegRNA that targets its own plasmidDepositorInsertsEGFP split with an intron between amino acids 95-96
pegRNA targeting its own plasmid
UseCRISPRExpressionMammalianMutationdisrupted 5' splice sitePromoterCMV and U6Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone1
Plasmid#162125PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgLKB1 clone2
Plasmid#162126PurposeLentiviral sgRNA plasmid targeting human LKB1DepositorInsertsgLKB1 (STK11 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0
Plasmid#62987PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationCas9 D10A nickase mutantAvailable SinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only