We narrowed to 14,386 results for: Cas9
-
Plasmid#245326PurposeCas9 CRISPRa positive control guide; targets CD4DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pSG1016-2xBsaI-SaKKH_P2A_EGFP
Plasmid#239461PurposeCodon-optimized S. aureus KKH Cas9. 2x BsaI sites for easy cloning of varying deaminases. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pE4F1.1.0-gDNA
Plasmid#132451PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertE4F1 (E4F1 Human)
UseCRISPRAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA B
Plasmid#127905PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_ATF4_2
Plasmid#72352PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFPDepositorInsertATF4 (ATF4 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ATF4_1
Plasmid#72351PurposeEncodes gRNA for 3' target of human ATF4 along with Cas9 with 2A GFPDepositorInsertATF4 (ATF4 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX458-AAVS1-sg
Plasmid#194721Purposepx458 with guide RNA that target hAAVS1DepositorArticleAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTF1.1.0-gDNA
Plasmid#113797PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MTF1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_DNMT3B
Plasmid#72366PurposeEncodes gRNA for 3' target of human DNMT3B along with Cas9 with 2A GFPDepositorInsertDNMT3B (DNMT3B Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZNF436.1.0-gDNA
Plasmid#113767PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF436DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXD1.1.0-gDNA
Plasmid#112446PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MXD1DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only