We narrowed to 10,242 results for: Uty
-
Plasmid#104167PurposeBacterial expression plasmid of anti-GFP nanobody with 3x Cysteines for maleimide labelingDepositorInsertAnti-GFP nanobody Enhancer PDB 3K1K (3x Cysteine)
Tags14x Histidine tag and NEDD8 from Brachypodium dis…ExpressionBacterialMutation3x Cysteines located at bps 493-495, 520-522, and…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
GB1-A11(2-196, D40G)-Strep
Plasmid#196210PurposeCodon-optimized bacterial expression plasmid. Expresses GB1-His6-TEV-A11(2-196, D40G)-Strep.DepositorInsertAnnexin A11 (ANXA11 Human)
TagsGB1-6xHis-TEV and Strep-II tagExpressionBacterialMutationD40GAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-mRuby3-WPRE
Plasmid#107744PurposeCan be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.DepositorInsertmRuby3
UseAAVExpressionMammalianPromoterCAGAvailable SinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-AmCyan
Plasmid#138481PurposeFor cloning sgRNA flanked by two ribozyme elements, to subsequently cloned into PL-5LTR-GW-A vector.DepositorInsertAmCyan
ExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEXneo-TrkB
Plasmid#190203PurposeTo express the Human TrkB receptor under the Moloney mouse sarcoma virus LTRDepositorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5-myc-Miro2 A13V
Plasmid#47896PurposeExpresses myc tagged Miro2 A13V constitutively active mutantDepositorInsertMiro2 A13V (RHOT2 Human)
TagsmycExpressionMammalianMutationA13V, constitutively active mutantPromoterCMVAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro-CAG-fl-STOP-fl-ZEB2-GFP-Flag-WPRE-poly(A)
Plasmid#165456PurposeInducible ZEB2 expression from AAVS1 locusDepositorAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
GB1-A11(2-196, G38R)-Strep
Plasmid#196209PurposeCodon-optimized bacterial expression plasmid. Expresses GB1-His6-TEV-A11(2-196, G38R)-Strep.DepositorInsertAnnexin A11 (ANXA11 Human)
TagsGB1-6xHis-TEV and Strep-II tagExpressionBacterialMutationG38RAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -