We narrowed to 11,589 results for: aga
-
Plasmid#192233Purposelentiviral vector expressing sgRNA-3 targeting eIF3 binding site of RPS4X 5'UTRDepositorInsertsgRNA-3 targeting eIF3 binding site of RPS4X 5'UTR (RPS4X Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#2/Cre
Plasmid#193236PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#1/Cre
Plasmid#193242PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTmem132d#2/Cre
Plasmid#193243PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZfp536#1/Cre
Plasmid#193248PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSphkap#2/Cre
Plasmid#193241PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sphkap geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#2/Cre
Plasmid#193238PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSis#1/Cre
Plasmid#193237PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Sis geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#2/Cre
Plasmid#193228PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#2/Cre
Plasmid#193230PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRos1#1/Cre
Plasmid#193233PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRos1#2/Cre
Plasmid#193234PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Ros1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRunx1t1#1/Cre
Plasmid#193235PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch1#2/Cre
Plasmid#193224PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNkx2-1#2/Cre
Plasmid#193222PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Nkx2-1 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNotch3#1/Cre
Plasmid#193227PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRnf43#1/Cre
Plasmid#173613PurposeExpresses a Rnf43-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Rnf43 (Rnf43 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSmad4#2/Cre
Plasmid#173618PurposeExpresses a Smad4-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Smad4 (Smad4 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNf2#2/Cre
Plasmid#173644PurposeExpresses a Nf2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Nf2 (Nf2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only