We narrowed to 7,276 results for: GFP expression plasmids
-
Plasmid#177427PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with G153A,G154A mutations in membrane binding region. Mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationGlycines 153 and 154 mutated to alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-G154STOP-pEGFP-C1
Plasmid#177428PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, truncatated within the membrane binding region (1-154). Stop codon added to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationGlycine 154 replaced with STOP codonPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CpxR-GFP
Plasmid#220150PurposeTo track the natural CpxR promoter's transcriptional dynamicsDepositorInsertCpxR promoter only
ExpressionBacterialAvailable SinceAug. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF6-GFP
Plasmid#67394PurposeMammalian expression of hArf6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL8B-GFP
Plasmid#67404PurposeMammalian expression of hArl8b with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL3-GFP
Plasmid#67397PurposeMammalian expression of hArl3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-SARA-GFP
Plasmid#67410PurposeMammalian expression of hSara with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL1-GFP
Plasmid#67395PurposeMammalian expression of hArl1 with C-term GFP tagDepositorInsertARL1 (ARL1 Human)
TagsGFPExpressionMammalianMutationbp 231 C to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL6-GFP
Plasmid#67401PurposeMammalian expression of hArl6 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL14-GFP
Plasmid#67406PurposeMammalian expression of hArl14 with C-term GFP tagDepositorInsertARL14 (ARL14 Human)
TagsGFPExpressionMammalianMutationbp 172 C to T; aa L58FPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARFRP1-GFP
Plasmid#67408PurposeMammalian expression of hArfrp with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF1-GFP
Plasmid#67390PurposeMammalian expression of hArf1 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL11-GFP
Plasmid#67407PurposeMammalian expression of hArl11 with C-term GFP tagDepositorInsertARL11 (ARL11 Human)
TagsGFPExpressionMammalianMutationbp 442 T to C; aa C148RPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4-GFP
Plasmid#67398PurposeMammalian expression of hArl4 with C-term GFP tagDepositorInsertARL4 (ARL4A Human)
TagsGFPExpressionMammalianMutationbp 105 A to T; silent mutationPromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF4-GFP
Plasmid#67392PurposeMammalian expression of hArf4 with C-term GFP tagDepositorInsertARF4 (ARF4 Human)
TagsGFPExpressionMammalianMutationV53A, L123P and M134I mutations were unintended P…PromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARF3-GFP
Plasmid#67391PurposeMammalian expression of hArf3 with C-term GFP tagDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-Ef1a-Puro-moxGFP
Plasmid#227273PurposeAAVS1 targeting donor for the insertion of Puro and a strong EF1a promoter expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-EF1a-moxGFP cassette (AAVS1 Synthetic)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only