We narrowed to 2,947 results for: SRS
-
Plasmid#220914PurposeExpresses DJ-1 with the C106A mutationDepositorAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only
-
P15-pZE-SUMO-PiTTA
Plasmid#204630PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized piTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-BuTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P17-pZE-SUMO-CsTTA
Plasmid#204631PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized csTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-CsTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P18-pZE-SUMO-BuTTA
Plasmid#204632PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized buTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-BuTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P24-pZE-SUMO-KaTTA
Plasmid#204633PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized kaTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-KaTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_PGK_3xHA-LTB4R(T308A)
Plasmid#208092PurposeMammalian expression of the human LTB4 receptor LTB4R with the T308A mutation with an N-terminal 3x HA tag.DepositorInsert3xHA-LTB4R(T308A) (LTB4R Human)
UseLentiviralTags3xHAExpressionMammalianMutationT308APromoterPGKAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_PGK_3xHA-LTB4R(S310A)
Plasmid#208093PurposeMammalian expression of the human LTB4 receptor LTB4R with the S310A mutation with an N-terminal 3x HA tag.DepositorInsert3xHA-LTB4R(S310A) (LTB4R Human)
UseLentiviralTags3xHAExpressionMammalianMutationS310APromoterPGKAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_PGK_3xHA-LTB4R
Plasmid#208091PurposeMammalian expression of the wild-type human LTB4 receptor LTB4R with an N-terminal 3x HA tag.DepositorInsert3xHA-LTB4R (LTB4R Human)
UseLentiviralTags3xHAExpressionMammalianMutationnonePromoterPGKAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNHT7
Plasmid#186753PurposeA basic cloning vector for inserting genes with 5' and 3' UTRs for later subcloning via Golden Gate assembly.DepositorTypeEmpty backboneUseSynthetic Biology; Cloning backbonePromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-3)
Plasmid#159664PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-2)
Plasmid#159663PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-1)
Plasmid#159662PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: Ascl1-1)
Plasmid#159656PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting mouse Ascl1.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Clim Actin MCH Puro (CAMP)
Plasmid#104446PurposeExpresses mCherry under endogenous actin promoter. It can be used to transfect Corallochytrium limacisporum (Corallochytrea) cells and visualize them by fluorescent microscope. Puromycin resistant.DepositorInsertmCherry
UseExpression in corallochytrium (single-celled euka…PromoteractinAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKD277
Plasmid#125098PurposeExpression of SO_2193(1-134aa)-psdR(134-237aa), ompR137 chimera under PLtetO-1, output Promoter PpsdA110DepositorInsertsSO_2193(REC)-psdR(DBD)137
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR357.20
Plasmid#125108PurposeExpression of narL(1-154aa)-ydfI(148-213aa) chimera under PLtetO-1, output Promoter PydfJ115DepositorInsertsnarL(REC)-ydfI(DBD)154
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR322.2
Plasmid#125117PurposeExpression of uhpA(1-118aa)-ydfI(121-213aa), narL126 chimera under PLtetO-1, output Promoter PydfJ115DepositorInsertsuhpA(REC)-ydfI(DBD)126
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR359.4
Plasmid#125115PurposeExpression of narL(1-159aa)-uhpA(142-129aa) chimera under PLtetO-1, output Promoter PuhpT99DepositorInsertsnarL(REC)-uhpA(DBD)159
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSR40.16
Plasmid#125083PurposeExpression of ompR(1-140aa)-ccaR(130-234aa) chimera under PLtetO-1, output Promoter PcpcG2-172DepositorInsertsompR(REC)-ccaR(DBD)140
sfgfp
tetR
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only