We narrowed to 16,664 results for: grn
-
Plasmid#246797PurposeA GreenGate entry vector containing a guide RNA expression cassette targeting the AtFT gene with 7 different gRNAsDepositorInsertAtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3- (FT Mustard Weed, Synthetic)
UseCRISPR; Greengate cloning entry vectorExpressionPlantAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1841
Plasmid#239797PurposepLV-U6-[SNCAintron1 gRNA 1]-EFSNC-dSaCas9-KRAB-MeCp2-P2A-Puro-WPRE (THERAPEUTIC VECTOR)DepositorInsertpLV-U6-[SNCAintron1 gRNA 1]-EFSNC-dSaCas9-KRAB-MeCp2-P2A-Puro-WPRE
UseLentiviralPromoterCMVAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK546
Plasmid#239839PurposepLV-U6-[hSNCA gRNA 4]-EFSNC-dSpCas9-DNMT3a-P2A-PURO-WPREDepositorInsertpLV-U6-[hSNCA gRNA 4]-EFSNC-dSpCas9-DNMT3a-P2A-PURO-WPRE
UseLentiviralPromoterCMVAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SQLE_sg2
Plasmid#244872PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SQLE_sg1
Plasmid#244871PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-0.5Syn-CasRx-pA
Plasmid#192492PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.5SynAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-3
Plasmid#237892PurposeCre-KO AAV vector#3 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-HITI-GFP-Ckm
Plasmid#226119PurposeHITI insert construct with Ckm gRNA and GFP transgeneDepositorAvailable SinceAug. 4, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVE-GhCLA
Plasmid#234929PurposeThis all-in-one vector is used to specifically knock out the GhCLA gene via virus-induced genome editing (VIGE).DepositorInsertGhCLA sgRNA
ExpressionPlantAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_LIG4_Exon3
Plasmid#225363PurposepX459 plasmid encoding the sgRNA protospacer sequence “5’-GCATAATGTCACTACAGATC-3’ to target the LIG4 gene.DepositorAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-30kb-DSF
Plasmid#227486Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-3mer-35kb-DSF
Plasmid#227492Purpose3-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-Fgf5Pro
Plasmid#227479Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-Fgf5Pro
Plasmid#227480Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-Fgf5Pro
Plasmid#227481Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-PrPro
Plasmid#227455Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only