We narrowed to 16,606 results for: grna
-
Plasmid#198402PurposeExpression of EGFP-tagged Aurora A in mammalian cellsDepositorInsertAurora A
TagsEGFPExpressionMammalianAvailable SinceMay 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDD428
Plasmid#202081PurposeCas9/sgRNA plasmid targeting the C-terminus of Myh9DepositorAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCast
Plasmid#200169PurposeE. coli/Yeast shuttle vector carrying CloNAT marker and Spcas9 allowing cloning of gRNA flanked by tRNA promoter and HDV ribozymeDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACRISPR
Plasmid#113348PurposeA sgRNA expression plasmid for genome editing in Pseudomonas aeruginosaDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI3M-TBD
Plasmid#113077PurposeExpresses enCas9 fused to PolI3M-TBD in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI3M-TBD
ExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCas9-sgAAVS1-2
Plasmid#129727PurposeExpressing SpCas9 and sgAAVS1-2DepositorInsertSpCas9 and sgAAVS1-2
UseCRISPRTagsT2A-mCherry-P2A-PuroExpressionMammalianPromoterhU6Available SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmBI
Plasmid#126028PurposePiggyBac cargo vector expressing rtTA, contains BsmBI sites for sgRNA cloningDepositorTypeEmpty backboneUseCRISPR; PiggybacExpressionMammalianPromoterU6Available SinceJune 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-chiRNA
Plasmid#45946PurposePlasmid for expression of chiRNA under the control of the Drosophila snRNA:U6:96Ab promoter.DepositorInsertU6-BbsI-chiRNA
UseCRISPRExpressionInsectPromoterDm-snRNA:U6:96AbAvailable SinceJune 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAS088
Plasmid#211502PurposeAAV genome backbone for AAV-Perturb-seq with direct gRNA capture and nuclei sorting based on eGFP.DepositorTypeEmpty backboneUseAAV, CRISPR, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSE901
Plasmid#91709PurposeCRISPR/Cas9-mediated base editing in dicots. Contains Cas9(D10A) under CaMV 35S promoter and empty gRNA scaffold, Basta resistanceDepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro-shSF3B1
Plasmid#248800PurposeKnockdown of endogenous SF3B1 with shRNA targeting 3'UTRDepositorInsertshRNA targeting SF3B1 3'UTR
UseLentiviralPromoterhPGKAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS316-RGR-GFP
Plasmid#51056PurposeExpress self-cleaving-ribozyme-flanked sgRNA cassette (RGR) targeting GFP for CRISPR systems in yeast driven by ADH1 promoter. RGR has a HH ribozyme at its 5', and an HDV ribozyme at its 3'.DepositorInsertRGR-GFP
UseCRISPRExpressionBacterial and YeastPromoterYeast ADH1 promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI5M
Plasmid#113078PurposeExpresses enCas9 fused to PolI5M in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI5M
UseCRISPRExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRDA_118
Plasmid#133459PurposeU6 promoter expresses customizable Spyo-guide; EF1a promoter provides puromycin resistance. This vector is a derivative of the lentiGuide vector, with minor modifications to the tracrRDepositorInsertcontrol guide
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Trono-EFS-Blast-P2A-TurboRFP
Plasmid#228893PurposeCloning and expression of gRNAs or pegRNAs with EcoRI/Esp3I insertion.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-scramble
Plasmid#118349PurposeThis plasmid expresses scrabled shRNA for use as a control for shRNA HSFs plasmids.DepositorInsertscrambled shRNA
ExpressionMammalianMutationWTAvailable SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEdit
Plasmid#232355PurposeThe pEdit series plasmids are derived from the pTarget series plasmids by inserting homologous recombination arms targeting the gene of interest, which enables gene knockout or gene insertion at the tDepositorInsertsgRNA
UseCRISPRAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only