We narrowed to 15,734 results for: AGA
-
Plasmid#184863PurposepSwap plasmid part containing the T1 sgRNA module for the Swap and Drop recombination system.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDropVn
Plasmid#184873PurposeChromosomal transfer helper plasmid with sgRNAs (one fixed, one flexible) for Vibrio natriegens genome editing protocol.DepositorInsertlacZalpha,ccdB
ExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLX-TRV1
Plasmid#180515PurposeAgrobacterium tumefaciens-based expression of TRV1DepositorInsertTobacco rattle virus RNA1
ExpressionPlantPromoter35S CaMVAvailable SinceApril 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAS3-rab-3P::AI::ChR2(H134R)
Plasmid#232601PurposePan-neuronal expression of opsin 'ChR2(H134R)', regulated by rab-3 promoter and unc-54 3' UTRDepositorInsertChannelrhodopsin2
ExpressionWormMutationH134RAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMGE-T7
Plasmid#153021PurposeSingle-plasmid multi-gene expression system. Each genes under the control of a T7 and the lacO promoter sequences.DepositorTypeEmpty backboneExpressionBacterialPromoterT7Available SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4.26_4xUAS_DSCP_GFP
Plasmid#111931PurposeVector to express GFP (under the control of the DSCP and an array of 4 UAS sites)DepositorInsert4xUAS GFP
ExpressionInsectAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec23A
Plasmid#66609PurposeGFP fusion of Sec23ADepositorAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-Sec31A
Plasmid#66613PurposeYFP fusion of Sec31ADepositorAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC016-gPsp-Control
Plasmid#233611PurposeExpression of guide RNA for PspCas13bDepositorInsertControl gRNA
UseCRISPRAvailable SinceJuly 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only