We narrowed to 18,366 results for: bon;
-
Plasmid#63965PurposePosition 2 transfer plasmid for pST44 polycistronic plasmid suite; N-term cleavable double tag; contains DHFR gene in BamHI-NgoMIV cassette as positive controlDepositorTypeEmpty backboneTags6xHis & FLAG; TEV cleavableExpressionBacterialPromoterT7Available SinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pAW8ENdeI-cyEGFP
Plasmid#48988Purposefor Cre-lox cassette exchange of C-terminal yEGFP tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTagsyEGFPAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-8XDSR
Plasmid#48981Purposefor Cre-lox cassette exchange of untagged gene sequences together with 8 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-c3HA
Plasmid#48989Purposefor Cre-lox cassette exchange of C-terminal 3XHA tagged gene sequences into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxTags3XHA tagAvailable SinceDec. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAW8ENdeI-3XDSR
Plasmid#48976Purposefor Cre-lox cassette exchange of untagged gene sequences together with 3 copies of the core DSR motif into the S. pombe urg1 locusDepositorTypeEmpty backboneUseCre/LoxAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
TAL-4GA1
Plasmid#41504DepositorInsert4GA1
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRET.IIS.IRES-EGFP
Plasmid#1838DepositorTypeEmpty backboneUseCre/Lox and RetroviralExpressionMammalianAvailable SinceApril 26, 2006AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p0AmpBC
Plasmid#237275PurposeEmpty vector for L0 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCTK119
Plasmid#248482PurposeEncodes p15A ori-KanR-LacI-TetR [GFP] as a Type 678 part to be used in the CTK/YTK systemsDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable SinceApril 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
p1ChlEF
Plasmid#237277PurposeEmpty vector for L1 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
p1ChlFG
Plasmid#237278PurposeEmpty vector for L1 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceMarch 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
MultiCAST-miniTn-Carb
Plasmid#248975PurposeMultiCAST mini-Tn donor plasmid containing ampicillin/carbenicillin selectable markerDepositorTypeEmpty backboneExpressionBacterialAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHREP-KD-1
Plasmid#240416PurposeSleeping Beauty vector for inducible expression of an shRNA using a shortened mir30 sequence. Allows co-selection with Puromycin.DepositorTypeEmpty backboneExpressionMammalianPromoterTREAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
p2KanEG
Plasmid#237279PurposeEmpty vector for L2 TypeIISDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pPtGE31_ΔPtR
Plasmid#236260PurposeA version of the episome pPtGE31 with a deleted nonessential region, contains the NAT cassetteDepositorTypeEmpty backboneUseSynthetic Biology; P. tricornutum expressionExpressionBacterial and YeastAvailable SinceJan. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pART7
Plasmid#247985PurposeCloning vector to transiently express an inserted gene in plant cells under the control of the 35S CaMV promoter.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDASH-DIS-α2 (MoClo)
Plasmid#242524PurposeDonor I vector in DASH and alpha2 vector in GoldenBraid/DASH, with SacB counter-selection, compatible with MoClo, with attBTT and attBCC-FRTDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
p3387_KanR_4p
Plasmid#247310PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3387 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPLacUV5Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB06_3360_6p
Plasmid#247311PurposeProduction of pinocembrin in Escherichia coli, cloned by BASIC assembly, based on 3360 in Carbonell et al. 2018DepositorInsertsAtCHI
AtCHS
Sc4CL
AtPAL
ExpressionBacterialPromoterPtrc with lac operator and noneAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only