We narrowed to 18,293 results for: erg
-
Plasmid#161806PurposeTransfer vector for gene expression to generate recombinant baculoviruses by homologous recombination. Contains expression cassette with an N-ter 10 His tag under the pH promoter.DepositorInsertN-terminal 10His tag
Tags10 HisExpressionInsectPromoterPHAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC8_MF-p10-mCh PH-mCh (VE5625)
Plasmid#139769PurposeTransfer vector for multigene expression to generate recombinant baculoviruses by homologous recombination. Contains a p10/pH dual expression cassette with an mCherry cDNA under each promoter.DepositorInsertmCherry fluorescent protein
ExpressionInsectPromoterPH or p10Available SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIK3CB gRNA (BRDN0001147768)
Plasmid#76194Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3CBDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-GOLPH3
Plasmid#21688DepositorInsertGolgi Phosphoprotein 3 (GOLPH3 Human)
UseGateway entry cloneMutationlast nucleotide of stop codon removed for c-termi…Available SinceJuly 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a del.SHD
Plasmid#40036DepositorInserthSlp4-a del.SHD (SYTL4 Human)
TagsEGFPExpressionMammalianMutationdeleted SHD domain (1-143)PromoterCMV promoterAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-193a-3p
Plasmid#103305PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-193a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-193a-3p target (MIR193A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-142-5p
Plasmid#103241PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-142-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-142-5p target (MIR142 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF0544
Plasmid#141641PurposeLentiviral vector for overexpressing the ZFAT transcription factor ORF with a unique 24-bp barcode. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
NME2 gRNA (BRDN0001487089)
Plasmid#77932Purpose3rd generation lentiviral gRNA plasmid targeting human NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
mIFP12-Clathrin-15
Plasmid#56249PurposeLocalization: Clathrin Vesicles, Excitation: 683, Emission: 704DepositorAvailable SinceApril 28, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-143-5p
Plasmid#103243PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-143-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-143-5p target (MIR143 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146019)
Plasmid#75540Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SGK3 gRNA (BRDN0001146281)
Plasmid#75541Purpose3rd generation lentiviral gRNA plasmid targeting human SGK3DepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
PNKP gRNA (BRDN0001147028)
Plasmid#77162Purpose3rd generation lentiviral gRNA plasmid targeting human PNKPDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKRA gRNA (BRDN0001146443)
Plasmid#76299Purpose3rd generation lentiviral gRNA plasmid targeting human PRKRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001145521)
Plasmid#77372Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW/TOPO-ELK1
Plasmid#98616PurposeGateway entry TOPO TA cloning vector for ELK1DepositorAvailable SinceSept. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-579-5p
Plasmid#103661PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-579-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-579-5p target (MIR579 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-302c-3p
Plasmid#103403PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-302c-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-302c-3p target (MIR302C Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only