We narrowed to 41,376 results for: LAT
-
Plasmid#23233DepositorAvailable SinceMarch 24, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pGL-FLKif3B
Plasmid#13743DepositorAvailable SinceJan. 29, 2007AvailabilityAcademic Institutions and Nonprofits only -
human p53-(1-360)
Plasmid#24865DepositorAvailable SinceAug. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GluA1-scFv-mNeon-KDEL
Plasmid#230056PurposeAAV plasmid that expresses a single chain variable fragment (scFv) for anti-GluA1 tagged with mNeon. Encodes an ER retrieval motif (KDEL) at C-terminus of mNeon.DepositorInsertAnti-GluA1 single chain variable fragment (scFv)
UseAAVTagsER retrieval motif (KDEL) and mNeonExpressionMammalianPromoterhuman synapsinAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDD121
Plasmid#91833PurposeCas9 expression in C. elegansDepositorInsertCas9
UseCRISPRExpressionWormMutationCodon optimized and with synthetic introns for C.…Available SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
H6-auxilin
Plasmid#62571Purpose6xHis-tagged full-length bovine brain auxilin (auxilin 1) in pQE30 for protein expression in bacteriaDepositorInsertAuxilin
Tags6XHisExpressionBacterialMutation*see comment belowAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
YEp181-CUP1-His-Smt3
Plasmid#99536PurposeYeast episomal vector for expression of His-tagged Smt3 (SUMO); LEU2 markerDepositorAvailable SinceAug. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-07
Plasmid#124786PurposeTemplate for C-terminal PCR tagging of mammalian genes (without selection) with mNeonGreenDepositorInsertmNeonGreen
UsePcr templateTagsmNeonGreenPromoterNoneAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJAT43
Plasmid#204299PurposeFor introducing heat shock inducble B3 recombinase. HDR integrant marked with ie1-EGFP, expressed in abdomen and mouthparts.DepositorInsertie1-EGFP
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTn7xTS-dTomato
Plasmid#117391PurposeTn7 tagging vector pTn7xTS with dTomato expression scaffoldDepositorInsertdTomato
UseSynthetic BiologyExpressionBacterialPromoterPtacAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pACYCDuet_WTDHFR_WTTS
Plasmid#91226Purposebacterial co-expression of folA (DHFR) and thyA(TS) with a barcode within the noncoding region between the genesDepositorInsertsfolA
thyA
Tags6xHisExpressionBacterialPromoterT7Available SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
Coronin1B-pmCherryN1
Plasmid#27694DepositorAvailable SinceMay 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
Casp1
Plasmid#98849PurposeExpresses murine Casp1 in mammalian cellsDepositorAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pN1-QUEEN7mu
Plasmid#129307PurposePositive control for ATP measurementDepositorInsertQUEEN-7mu
ExpressionMammalianAvailable SinceNov. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSBDEST.B
Plasmid#79460PurposePromoterless, Sleeping Beauty-compatible Gateway destination vector, Blasticidin selectionDepositorTypeEmpty backboneUsePromoterless gateway destination vectorPromoternoneAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHA-PUMA DeltaBH3
Plasmid#16589DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
MK1274
Plasmid#71431PurposeThis E. coli DH10B strain harbors a shuttle vector plasmid that expresses the Mixed Feedback Loop version of the UBER system with a T7RNAP translation rate of 300 and a TetR translation rate of 35149.DepositorInsertMixed Feedback Loop version of the UBER system
MutationT7 RBS:AACCGAGCCCAATATAGGACTCAGGGTGCCAAAAAA and T…Available SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJPT003-PM-HaloTag-1x FLAG
Plasmid#202494PurposeExpress "PM" HaloTagDepositorInsertHaloTag
Tags1x FLAG and Palmitoylation-Myristoylation SiteExpressionMammalianPromoterCMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pDB4282
Plasmid#98701PurposeA plasmid containing the 3' portion of the ura4 marker and the gRNA elements downstream of the target sequence. It serves as the PCR template for generating the gRNA insert in the split-ura4 systemDepositorInsertgRNA PCR template
UseCRISPRExpressionYeastAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only