We narrowed to 23,721 results for: ACE
-
Plasmid#17693DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only
-
pTPTP alpha (CCSS)
Plasmid#17692DepositorAvailable SinceApril 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBABE-FLAG-hG9a
Plasmid#33023DepositorInserthG9a
UseRetroviralTagsFlagExpressionMammalianPromoter5'LTRAvailable SinceApril 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TB
Plasmid#48656PurposeBacterial TD crRNA expression: targets TD to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pIVEX-anchor
Plasmid#46844PurposeTemplate for the amplification of spiking anchors in BeSDDepositorTypeEmpty backboneUseIn vitro expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-B
Plasmid#48663PurposeBacterial TD repression YFP reporter: protospacer BDepositorInsertTD prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-TD!TA
Plasmid#48655PurposeBacterial TD crRNA expression: targets TD to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial TD crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRS414-59
Plasmid#23087DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Serine 10 to Alanine, H3 S10A.Available SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-NM-A
Plasmid#48664PurposeBacterial NM repression YFP reporter: protospacer ADepositorInsertNM prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-A
Plasmid#48666PurposeBacterial TD repression YFP reporter: protospacer ADepositorInsertTD prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJD112
Plasmid#23088DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone 3 Changed Serine 10 to Aspartate, H3 S10D.Available SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pJD113
Plasmid#23089DepositorInsertyeast Histone H3-2 and Histone H4-2
ExpressionYeastMutationHistone H3 changed Serine 10 to Glutamamte, H3 S1…Available SinceFeb. 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
pMyt1(502-736)
Plasmid#22654DepositorInsertMyelin Transcription Factor 1 (Myt1 Mouse)
ExpressionMammalianMutationOnly bp 2035-2739 or CD of mouse Myt1Available SinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMyt1(617-736)
Plasmid#22656DepositorInsertmyelin Transcription Factor 1 (Myt1 Mouse)
ExpressionMammalianMutationSecond 1/2 of Myt1 central domain (2380-2739Available SinceNov. 24, 2009AvailabilityAcademic Institutions and Nonprofits only -
pNTPTP alpha (Y789F)
Plasmid#17702DepositorAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pNA0304
Plasmid#165612PurposeVector for expression of sgRNAs in yeast: SNR52p-NotI-sgRNA-SUP4t (NotI site in place of the spacer)DepositorInsertSNR52p-NotI-sgRNA-SUP4t (S. cerevisiae SNR52 promoter driving the sgRNA for SpCas9, with a NotI site in place of the spacer)
UseCRISPRExpressionYeastMutationNotI site replaced the CAN1 spacer in parent vect…PromoterSNR52Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
GW1-PercevalHR
Plasmid#49082PurposeMammalian expression vector (CMV promoter) of PercevalHR, a fluorescent sensor of ATP-to-ADP ratio.DepositorInsertPercevalHR
ExpressionMammalianAvailable SinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only