We narrowed to 14,321 results for: cas9
-
Plasmid#174148PurposeLentiviral vector expressing Cas9 and a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Mouse CRISPRi sgRNA library Dolomiti in backbone XPR_050, Set A
Pooled library#104090PurposeCrispriDepositorUseLentiviralAvailable sinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEL081
Plasmid#137890PurposeiSTU-CRISPR/Cas9 with OsCDPK2 intron, tRNA structure backboneDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCLV3Cas-LT1
Plasmid#210549PurposeBinary vector expressing the Lineage Tracing system. Cas9 expression driven by CLV3 promoter. LT1 reporterDepositorInsertCLV3p::spCas9::PEA3At::U6p::AAVS1gRNA::pHTR5::LT1::mCherrySSM
ExpressionPlantMutation2bp insertion after AAVS1 target sequence that di…Available sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pODN-AAVS1-mR2-CAAX
Plasmid#183871PurposeRepair template for the stable expression of a mRuby2-CAAX fusion in human cells using CRISPR/Cas9.DepositorInsertAAVS1 homology arms with CMV-driven mRuby2-CAAX fusion (AAVS1 Human)
UseCRISPR; Donor templateTagsmRuby2-CAAXExpressionMammalianMutationHomology arms contain point mutations to remove t…PromoterCMVAvailable sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ECT2
Plasmid#183835PurposeRepair template for the N-terminal tagging of Ect2 with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertECT2 homology arms with mNeonGreen-linker (ECT2 Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available sinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9336 (pgRNA_II-1_NatMX)
Plasmid#161589PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site II-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL193
Plasmid#180471PurposeFor expression of Cas9 and gRNAs, multiple gRNAs cloning vectorDepositorTypeEmpty backboneUseCRISPRTagsCas9ExpressionPlantAvailable sinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable sinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMPC2_7
Plasmid#163457Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 7 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLentiCRISPR-v1-sgMPC2_9
Plasmid#163458Purposelentiviral vector expressing Cas9 and an sgRNA targeting MPC2DepositorInsertsgRNA 9 targeting GPT2 (MPC2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-MRPsg2
Plasmid#87190Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 2DepositorAvailable sinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg4
Plasmid#87192Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 4DepositorAvailable sinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 2
Plasmid#70660PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSG1039-rA1-SaKKH_P2A_EGFP
Plasmid#239462PurposeCytosine base editor with codon-optimized S. aureus KKH Cas9 and rAPOBEC1 deaminase. EGFP can be used as a transfection marker.DepositorInsertS.a. rA1 CBE
UseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable sinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330.orup
Plasmid#110404PurposeCRISPR/Cas9 vector with sgRNA expression and puromycin resistanceDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBhAvailable sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKGFP2ABFP-W
Plasmid#67983PurposeCas9 activity reporter (control) with GFP and BFPDepositorInsertU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable sinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGEM-PAmCherry-RPA194
Plasmid#247354PurposeCRISPR/Cas9 donor plasmid to tag human RPA194 with PAmCherryDepositorAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only