We narrowed to 11,308 results for: ENA
-
Plasmid#189785PurposeGolden Gate entry vector to clone the 4th Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ131-RZ-Cas12j2
Plasmid#173927PurposeGolden Gate entry vector; empty vector to clone the 1st Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-RZ-Cas12j2
Plasmid#173928PurposeGolden Gate entry vector; empty vector to clone the 2nd Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-RZ-Cas12j2
Plasmid#173929PurposeGolden Gate entry vector; empty vector to clone the 3rd Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-RZ-Cas12j2
Plasmid#173930PurposeGolden Gate entry vector; empty vector to clone the 4th Cas12j2 crRNA with ribozyme processingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::PpsbA2*::B0032::CYP110D1
Plasmid#186707PurposeCYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1
Plasmid#186709PurposeCYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOD_004
Plasmid#155361PurposeGentamycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOD_003
Plasmid#155362PurposeZeomycin version of the scarless genome engineering pDEL plasmid (Tikh et al. 2016) compatible with SalmonellaDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 30, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1031
Plasmid#189584PurposeEdH4gp0214 deletion HR vector 250bp HR Arms (EdH4 phage editing)DepositorInsertEdH4gp0214 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of EdH4gp0214Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBA1030
Plasmid#189582PurposeEdH4gp0004 deletion HR vector 250bp HR Arms (EdH4 phage editing)DepositorInsertEdH4gp0004 Deletion Locus 250bp Homology Arms
UseSynthetic BiologyExpressionBacterialMutationEncodes for a full deletion of EdH4gp0004Available SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MTOR
Plasmid#183311PurposeAll-in-One CRISPRko system with a guide RNA that targets MTOR geneDepositorInsertMTOR
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BRAF
Plasmid#183273PurposeAll-in-One CRISPRko system with a guide RNA that targets BRAF geneDepositorInsertBRAF
UseLentiviralAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK028
Plasmid#180826PurposeT7-inducible expression construct to produce SwGdmA (SWIT_RS16490) in E. coliDepositorArticleInsertSwGdmA (SWIT_RS16490 Sphingomonas wittichii RW1, Synthetic)
Tags6X HisExpressionBacterialPromoterT7Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK037
Plasmid#180829PurposeT7-inducible expression construct to produce CnGdmB (CNE_RS35790) in E. coliDepositorArticleAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEUK066
Plasmid#180830PurposeT7-inducible expression construct to produce NaGdmA (SARO_RS07455) in E. coliDepositorArticleInsertNaGdmA
Tags6X HisExpressionBacterialPromoterT7Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CYP19A1
Plasmid#183280PurposeAll-in-One CRISPRko system with a guide RNA that targets CYP19A1 geneDepositorInsertCYP19A1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DHFR
Plasmid#183281PurposeAll-in-One CRISPRko system with a guide RNA that targets DHFR geneDepositorInsertDHFR
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FLT1
Plasmid#183292PurposeAll-in-One CRISPRko system with a guide RNA that targets FLT1 geneDepositorInsertFLT1
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_YES1
Plasmid#183329PurposeAll-in-One CRISPRko system with a guide RNA that targets YES1 geneDepositorInsertYES1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TYMS
Plasmid#183326PurposeAll-in-One CRISPRko system with a guide RNA that targets TYMS geneDepositorInsertTYMS
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ROS1
Plasmid#183320PurposeAll-in-One CRISPRko system with a guide RNA that targets ROS1 geneDepositorInsertROS1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_SMO
Plasmid#183321PurposeAll-in-One CRISPRko system with a guide RNA that targets SMO geneDepositorInsertSMO
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RET
Plasmid#183319PurposeAll-in-One CRISPRko system with a guide RNA that targets RET geneDepositorInsertRET
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_RARA
Plasmid#183318PurposeAll-in-One CRISPRko system with a guide RNA that targets RARA geneDepositorInsertRARA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PSMB5
Plasmid#183317PurposeAll-in-One CRISPRko system with a guide RNA that targets PSMB5 geneDepositorInsertPSMB5
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PIK3CD
Plasmid#183316PurposeAll-in-One CRISPRko system with a guide RNA that targets PIK3CD geneDepositorInsertPIK3CD
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PIGF
Plasmid#183315PurposeAll-in-One CRISPRko system with a guide RNA that targets PIGF geneDepositorInsertPIGF
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MET
Plasmid#183310PurposeAll-in-One CRISPRko system with a guide RNA that targets MET geneDepositorInsertMET
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K2
Plasmid#183309PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K2 geneDepositorInsertMAP2K2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_MAP2K1
Plasmid#183308PurposeAll-in-One CRISPRko system with a guide RNA that targets MAP2K1 geneDepositorInsertMAP2K1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_LCK
Plasmid#183307PurposeAll-in-One CRISPRko system with a guide RNA that targets LCK geneDepositorInsertLCK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_KIT
Plasmid#183306PurposeAll-in-One CRISPRko system with a guide RNA that targets KIT geneDepositorInsertKIT
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_KDR
Plasmid#183305PurposeAll-in-One CRISPRko system with a guide RNA that targets KDR geneDepositorInsertKDR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK3
Plasmid#183304PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK3 geneDepositorInsertJAK3
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_JAK1
Plasmid#183302PurposeAll-in-One CRISPRko system with a guide RNA that targets JAK1 geneDepositorInsertJAK1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC1
Plasmid#183297PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC1 geneDepositorInsertHDAC1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FYN
Plasmid#183295PurposeAll-in-One CRISPRko system with a guide RNA that targets FYN geneDepositorInsertFYN
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CYP17A1
Plasmid#183279PurposeAll-in-One CRISPRko system with a guide RNA that targets CYP17A1 geneDepositorInsertCYP17A1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CSF3R
Plasmid#183278PurposeAll-in-One CRISPRko system with a guide RNA that targets CSF3R geneDepositorInsertCSF3R
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK6
Plasmid#183276PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK6 geneDepositorInsertCDK6
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_CDK4
Plasmid#183275PurposeAll-in-One CRISPRko system with a guide RNA that targets CDK4 geneDepositorInsertCDK4
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BTK
Plasmid#183274PurposeAll-in-One CRISPRko system with a guide RNA that targets BTK geneDepositorInsertBTK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_BCL2
Plasmid#183272PurposeAll-in-One CRISPRko system with a guide RNA that targets BCL2 geneDepositorInsertBCL2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_AR
Plasmid#183271PurposeAll-in-One CRISPRko system with a guide RNA that targets AR geneDepositorInsertAR
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ALK
Plasmid#183270PurposeAll-in-One CRISPRko system with a guide RNA that targets ALK geneDepositorInsertALK
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ADA
Plasmid#183269PurposeAll-in-One CRISPRko system with a guide RNA that targets ADA geneDepositorInsertADA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only