We narrowed to 25,345 results for: Spr
-
Plasmid#188770PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA NC
Plasmid#176256PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and spacer sequence is replaced by the type IIS restriction site for endonuclease BaeI that can beDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3F2-mCherry
Plasmid#73418PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3F2.DepositorInsertPromoter 3F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux_crRNA NR1
Plasmid#176244PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP320-pAAV-U6SaCas9gRNA(CREB3)_EFS-GFP-KASH-pA
Plasmid#113697PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT7-5)-PGKpuro2ABFP-W
Plasmid#159287PurposeLentiviral vector expressing gRNA targeting KAT7 (gRNA ID. 5)DepositorInsertguide RNA targeting KAT7 (ID. 5) (KAT7 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pETM6-3A2-mCherry
Plasmid#73425PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 3A2.DepositorInsertPromoter 3A2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP3A2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant
Plasmid#101208PurposeBacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A and Q695APromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-5F5-mCherry
Plasmid#73422PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 5F5.DepositorInsertPromoter 5F5 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP5F5 (orthogonal T7-lac variant)Available SinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJSC011 - Bacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variant
Plasmid#101229PurposeBacterial expression plasmid for SpCas9 Cluster 1 (HypaCas9), HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N692A/M694A/Q695A/H698A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N692A, M694A, Q695A an…PromoterT7Available SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-LMNB1
Plasmid#227328PurposeDonor template for mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a mStayGold Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-KO-Puro-TP53
Plasmid#227319PurposeDonor template for 2A-Puro insertion into the N-terminus of the TP53 locus. For selectable p53 knock-out. To be co-transfected with sgRNA plasmid px330-TP53 (Addgene #227318)DepositorInsertTP53 Homology Arms flanking a 2A-Puro Cassette (TP53 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-ARL13B
Plasmid#227277PurposeDonor template for mStayGold insertion into the C-terminus of the ARL13B locus. For cilia visualization. To be co-transfected with sgRNA plasmid pX330-PITCh-ARL13B (Addgene #227276)DepositorInsertARL13B Homology Arms flanking a mStayGold Tag (ARL13B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-EFS-Puro-CEP192
Plasmid#227290PurposeDonor template for mStayGold-EFS-Puro insertion into the C-term of CEP192 locus. For pericentriolar material visualization. To be co-transfected with sgRNA plasmid px330-PITCh-CEP192 (Addgene #227288)DepositorInsertCEP192 Homology Arms flanking a mStayGold-EFS-Puro Cassette (CEP192 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459_TELO2_gRNA
Plasmid#224379PurposeTargets TELO2 for dTAG N terminal knock-in cell linesDepositorAvailable SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only