We narrowed to 26,877 results for: crispr grnas
-
Plasmid#194898PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-3 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.3
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No9
Plasmid#194903PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-9 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.9
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_HEK4_20-7
Plasmid#201974PurposeExpress a pegRNA used for 20bp tag insertion at HEK4 site with a 7bp homology armDepositorInsertpegRNA_HEK4_20-7
ExpressionMammalianAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pegRNA_HEK4_G-T
Plasmid#201975PurposeExpress a pegRNA used for G to T conversion at HEK4 siteDepositorInsertpegRNA_HEK4_G-T
ExpressionMammalianAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No4
Plasmid#194899PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-4 targeting the promoter of human MECP2DepositorInsertsgRNA targeting human MECP2 promoter No.4
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No8
Plasmid#194902PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-8 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.8
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No6
Plasmid#194900PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-6 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.6
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA_hMECP2_promoter_No7
Plasmid#194901PurposeLentiviral construct with mCherry and Puro cassettes to express sgRNA-7 targeting the promoter of human MECP2.DepositorInsertsgRNA targeting human MECP2 promoter No.7
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSMART-sgRNA (Sp)
Plasmid#80427PurposeU6 promoter driven sgRNA expression plasmid. Annealed oligonucleotides encoding crRNA sequence are ligated into BbsI site.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-GBA-10
Plasmid#199271PurposepegRNA used to induce GBA (c. 1226 A > G) mutationDepositorInsertGBA 1226AtoG pegRNA
ExpressionMammalianAvailable SinceApril 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g10
Plasmid#120218PurposeCENPB CRISPRi guide RNA 10DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG79-attL1-pegRNA-attL2
Plasmid#213050PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL3-pegRNA-attL2
Plasmid#213052PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL3 and attL2DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR3
Plasmid#213051PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attR4-pegRNA-attR3
Plasmid#213056PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attR4 and attR3DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL5-pegRNA-attL4
Plasmid#213055PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attL4DepositorInsertsgRNA
ExpressionBacterialPromoter35S-CmYCLV-AtU6Available SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only