We narrowed to 32,805 results for: LIS
-
Plasmid Kit#1000000229PurposeCollection of plasmids which extend the capabilities of the MoClo Yeast Toolkit (YTK) for genetically engineering S. cerevisiae.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeGolden Gate (MoClo)Available SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only
-
CyanoGate Kit
Plasmid Kit#1000000146PurposeVectors for generating multi-part assemblies in either integrative (suicide) or self-replicating plasmid vectors for working in cyanobacteria.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden Gate (MoClo)Available SinceJan. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_gRNA_1
Plasmid#196625PurposeKnock-out STING in murine cells, gRNA 1.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4-AARE-luc2P-Hygro
Plasmid#101787PurposeLuferase reporter plasmid containing three tandem repeats of the amino acid response element (AARE)DepositorInsert3xAARE
UseLuciferaseTagsLuciferaseExpressionMammalianPromoterminimal TATA-box promoter with low basal activityAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mSTING_gRNA_2
Plasmid#196626PurposeKnock-out STING in murine cells, gRNA 2.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSS02:cyt-Peredox-mCherry_DS
Plasmid#161747Purposecytosolic expression of fluorescent NADH/NAD+ biosensor Peredox-mCherry in plantsDepositorInsertcyt-Peredox-mCherry_DS
ExpressionPlantMutationamino acid substitution D115S in first T-Rex doma…PromoterUbiquitin 10Available SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-mFgf21pro1-luc
Plasmid#101797PurposeReporter for mouse Fgf21 promoter activityDepositorInsertFibroblast growth factor 21 promoter (Fgf21 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-mFgf21pro2-luc
Plasmid#101798PurposeReporter for mouse Fgf21 promoter activityDepositorInsertFibroblast growth factor 21 promoter (Fgf21 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL3-mFgf21pro3-luc
Plasmid#101799PurposeReporter for mouse Fgf21 promoter activityDepositorInsertFibroblast growth factor 21 promoter (Fgf21 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTL
Plasmid#203176PurposeCentromeric yeast expression vector, leucine selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceAug. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV PHP.eB)
Viral Prep#162375-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE (AAV9)
Viral Prep#162380-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE (#162380). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8s-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (AAV5)
Viral Prep#162382-AAV5PurposeReady-to-use AAV5 particles produced from pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE (#162382). In addition to the viral particles, you will also receive purified pGP-AAV-CAG-FLEX-jGCaMP8f-WPRE plasmid DNA. CAG-driven, Cre-dependent expression of the ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV9)
Viral Prep#162377-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV1)
Viral Prep#162377-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8m-WPRE (AAV Retrograde)
Viral Prep#162375-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP8m-WPRE (#162375). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8m-WPRE plasmid DNA. Syn-driven expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (AAV9)
Viral Prep#162378-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-FLEX-jGCaMP8m-WPRE (#162378). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8m-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8m (faster, more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 22, 2021AvailabilityAcademic Institutions and Nonprofits only