We narrowed to 14,780 results for: sta
-
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-EBFP2-OptoSTIM1(CRY2clust)
Plasmid#184716PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRMTK-clo3'
Plasmid#203924PurposeCloning plasmid containing the ColE1 origin insert with an ampicillin resistance markerDepositorInsertColE1 Origin of Replication
ExpressionPlantPromoterN/AAvailable sinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBP-P_TALEsp1_PUPsp1-phlF_PPhlF
Plasmid#204080PurposeType 0 promoter partDepositorInsertTALEsp1-stabilized promoter driving phlF repressor; PPhlF DAPG-inducible promoter
ExpressionBacterialMutationNoneAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTrc-CysGA-Im7 F84A
Plasmid#201082PurposeIm7 F84A variant inserted into CysGA at G364 via GS linkerDepositorInsertCysGA-Im7 F84A
ExpressionBacterialMutationIm7 F84APromoterpTrcAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pH6-mNeonC
Plasmid#178461PurposeThe mNeonGreen fluorescent protein with an N-terminal 6xHis and a C-terminal free-Cysteine in pET28aDepositorInsertmNeonGreen
Tags6xHisExpressionBacterialMutationFree cysteine at the C-terminusPromoterT7Available sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-TUBB2a-mEos3.2
Plasmid#191320PurposeExpresses fuorescently labeled beta tubulin to allow photoconversion of microtubule patches from green to red fluorescent with UV lightDepositorInsertTUBB2a-mEos3.2 (Tubb2a Mouse)
ExpressionMammalianAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2Katushka-ter-Hygromycin
Plasmid#184772PurposeRed marker for yeast late Golgi/early endosome. Integration of 2xKatushka tag at SEC7 C terminus. Uses antibiotic resistance marker hphMX6.DepositorAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBetaActin-TUBB2a-Dronpa
Plasmid#191321PurposeExpresses fuorescently labeled beta tubulin to allow photoactivation of microtubule patches with very little UV lightDepositorInsertTUBB2a-Dronpa (Tubb2a Mouse)
ExpressionMammalianAvailable sinceJan. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGS_591
Plasmid#160653PurposeExpresses OLE1 under the control of the yeast Sup35 promoterDepositorAvailable sinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP768_L2pV1_NOR_B3RT_FRT_Rluc_0I_lacZ
Plasmid#192428PurposeTo act as the 0-input state of the NOR gate.DepositorInsertAct2::FRT-B3RT-Rluc-B3RT-FRT
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP727_L2_pV01_0I_TMV-rLUC_TCTP-fLUC
Plasmid#192370PurposeTo control for variation introduced to the gene circuits, Rluc expression not affected by the introduction of terminators or recombination target sites.DepositorInsertAct2::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP770_L2pV1_NOR_B3RT_FRT_Rluc_1IB_lacZ
Plasmid#192430PurposeTo act as a 1-input state of the NOR gate.DepositorInsertAct2::FRT-B3RT-Rluc-B3RT-FRT
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP769_L2pV1_NOR_B3RT_FRT_Rluc_1IF_lacZ
Plasmid#192429PurposeTo act as a 1-input state of the NOR gate.DepositorInsertAct2::FRT-B3RT-Rluc-B3RT-FRT
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP771_L2pV1_NOR_B3RT_FRT_Rluc_2IFB_lacZ
Plasmid#192431PurposeTo act as a 2-input state of the NOR gate.DepositorInsertAct2::FRT-B3RT-Rluc-B3RT-FRT
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP717_L2sV3_NAND_2I_FRT_Rluc_Flp-C1_lacZ
Plasmid#192417PurposeTo act as the 2-input state of the split-NAND gate.DepositorInsertFRT-Act2-FRT::RlucRluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP715_L2sV3_NAND_1IF1_FRT_Rluc_FlpF1_C1-NLS_lacZ
Plasmid#192415PurposeTo act as a 1-input state of the split-NAND gate.DepositorInsertFRT-Act2-FRT::RlucRluc
UseSynthetic BiologyTagsPESTExpressionPlantAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
ND6-L1397-N_Q1310A_right
Plasmid#187849Purposeexpresses the right-side half ND6-Q1310A in mammalian cellsDepositorInsertCOX8A MTS–3xFLAG–ND6 right TALE–G1397 DddA-C–UGI–ATP5B 3'UTR
ExpressionMammalianAvailable sinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
ND6-L1397-N_Q1310A_left
Plasmid#187848Purposeexpresses the left-side half ND6-Q1310A in mammalian cellsDepositorInsertSOD2 MTS–3x-HA–ND6 left tale–G1397 DddA-N(Q1310A)–UGI–SOD2 3'UTR
ExpressionMammalianAvailable sinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpd_v2 (opti)
Plasmid#177250PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpd gRNADepositorInsertsgCebpd_2nd
UseLentiviralPromoterhU6Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only