We narrowed to 24,652 results for: crispr
-
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSc2
Plasmid#80437PurposeExpresses eGFP along with an U6 promoter driven gRNA which cleaves the plasmid in-cellDepositorInsertssp Cas9 gRNA
eGFP
UseCRISPRExpressionMammalianPromoterCMV and U6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT526
Plasmid#180513PurposePlasmid expressing mammalian codon optimized wt PlmCasX, mNeonGreen, sgRNAv1 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv1
PlmCasX-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-Esrrb gRNA
Plasmid#128841PurposegRNA for targeting mouse Esrrb locus using CRISPR-cas techniqueDepositorInsertEsrrb gRNA (Esrrb Mouse)
UseCRISPRAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.S_mCherry-NLS
Plasmid#178276PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.Ollas_mCherry-NLS
Plasmid#178259PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.Ollas and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.NWS_mCherry-NLS
Plasmid#178258PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.NWS and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
nCas9-UGI control for Target-AID (pRZ1047)
Plasmid#131299PurposeCAG promoter expression plasmid for NLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP (Target-AID without pmCDA1).DepositorInsertNLS-hSpCas9n(D10A)-NLS-SH3-3xFLAG-NLS-UGI-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable SinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
Plasmid#171102PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Otx2.DepositorAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E4 (GB2241)
Plasmid#160563PurposetRNA and scaffold for the assembly of GBoligomers for position [4-5] of a polycistronic tRNA-gRNA.DepositorInsertMultiplexing Edit (E4)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AcrIIC1X* (AcrIIC1X-mCherry chimera)
Plasmid#128114PurposeExpresses AcrIIC1(N3F/D15Q/A48I) fused to mCherry; mediates potent inhibition of both, N. meningitidis as well as S. aureus Cas9DepositorInsertAcrX* (AcrIIC1 N3F/D15Q/A48I fused to mCherry)
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMVAvailable SinceDec. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_GFP_UBE2H_sg4
Plasmid#254544PurposeUBE2H knockoutDepositorAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti_Cas9_mCherry_UBE2H_sg4
Plasmid#254545PurposeUBE2H knockoutDepositorInsertUBE2H (UBE2H Human)
UseCRISPR and LentiviralTagsFLAG-SV40NLS and nucleoplasminNLS-P2A-mCherryAvailable SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-mini-sgRNA
Plasmid#246934Purposefor HEK293T human cell genome editingDepositorInsertLaTranC mini-sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-FAM13A
Plasmid#185550PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting FAM13ADepositorInsertFAM13A gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA320
Plasmid#215952PurposeFragmid fragment: (guide cassette) guide expression; reverse orientation; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertrev{U6_v1; DR_v0 [EnAs]; sgCD47_v1 [EnAs]; DR_v1 [EnAs]; sgCD47_v2 [EnAs]}
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only