We narrowed to 12,158 results for: SOM
-
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS607c
Plasmid#87388PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-SAP155b
Plasmid#87389PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155b sequence GGTTTTCATACTGGGGCCGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS805a
Plasmid#87393PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1206a
Plasmid#87398PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1206a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1414a
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV mCherry-GFP-LC3B WT
Plasmid#123230PurposeExpresses mCherry-EGFP-LC3B wild-type in mammalian cells. Fluorescent tandem reporter for autophagosomes. High expression driven by CMV promoter.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsEGFP and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCE-mp53DD
Plasmid#41856PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCE-hUL
Plasmid#41855PurposeNon-integrating (episomal) expression of human L-MYC and LIN28DepositorAvailable SinceMarch 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-SOD2-2A-Catalase-WPRE
Plasmid#67635PurposeAAV vector expressing both SOD2 and mitochondrial targeted CatalaseDepositorUseAAVMutationDeleted the Peroxisome Targeting Signal from Cata…PromoterCMVAvailable SinceAug. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PalmGRET
Plasmid#158221PurposeBRET-based reporter to enable pan-extracellular particle labelling ranging from exomeres (< 50 nm) to small (< 200 nm; e.g. exosomes) and medium and large (> 200 nm; e.g. microvesicles) EVs.DepositorInsertPalmGFP-Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-mp53DD
Plasmid#41859PurposeNon-integrating (episomal) expression of mouse p53DD - p53 carboxy-terminal dominant-negative fragmentDepositorAvailable SinceJuly 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ASAP4e-Kv-WPRE
Plasmid#201031PurposeExpresses somatically enriched ASAP4e in neurons, can be used to package AAVDepositorInsertASAP4e-Kv
UseAAVAvailable SinceJuly 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV mClover3-Galectin-3
Plasmid#215376PurposeExpression of the endolysosomal damage marker Galectin-3 with an N-terminal mClover3 tag.DepositorInsertLGALS3 (LGALS3 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV mRuby3-Galectin-3
Plasmid#215375PurposeExpression of the endolysosomal damage marker Galectin-3 with an N-terminal mRuby3 tag.DepositorInsertLGALS3 (LGALS3 Human)
ExpressionMammalianAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Villinpromoter-blue-FlpOERT2
Plasmid#67278Purpose4hydroxytamoxifen inducible FlpO recombinase controlled by intestine specific promoter (Villin). FlpO is linked to mTQ2 -a blue fluorescent protein. The gene cassette is in a SB transposon contextDepositorInsertVillin-mTQ2-P2A-FlpO-ERT2
TagsmTQ2, linked to FlpO through an P2A ribosomal ski…ExpressionMammalianPromoterVillinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
GBX
Plasmid#64123Purposea modified episomal (EBNA1/OriP) vector expressing human eGFP and BCL-xL genesDepositorAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-FLEX-[FGL-2A-palmRFP1]
Plasmid#190236PurposeAAV vector, high-level expression of somatodendritic-targeted EGFP (FGL) and membrane-targted mRFP1 (palmRFP1) in neuronal cells in the presence of Cre recombinaseDepositorInsertEGFP
UseAAVTagsF2A, LDLR C-terminal sequence, mRFP1, myristoylat…ExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-LAMP1
Plasmid#207788PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the LAMP1 locus. For lysosome visualization.To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a moxGFP-Puro Cassette (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceDec. 1, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits