We narrowed to 16,371 results for: nans
-
Plasmid#212372PurposeEncodes SARS-CoV-2 spike deltaH69-H70, Y453F, D614G, I692V, M1229I for pseudovirus productionDepositorInsertSARS-CoV-2 Spike deltaH69-H70, Y453F, D614G, I692V, M1229I (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationdeltaH69-H70, Y453F, D614G, I692V, M1229IPromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 deltaL242-L244+R246I (ATA)
Plasmid#212357PurposeEncodes SARS-CoV-2 spike deltaL242-L244, R246I for pseudovirus productionDepositorInsertSARS-CoV-2 Spike deltaL242-L244, R246I (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationdeltaL242-L244, R246IPromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 SAK005321 (Wrong L242H)
Plasmid#212350PurposeEncodes SARS-CoV-2 spike D80A, D215G, L242H, K417N, E484K, N501Y, D614G, A701V for pseudovirus productionDepositorInsertSARS-CoV-2 Spike D80A, D215G, L242H, K417N, E484K, N501Y, D614G, A701V (S Severe acute respiratory syndrome coronavirus 2)
ExpressionMammalianMutationD80A, D215G, L242H, K417N, E484K, N501Y, D614G, A…PromoterCAGAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-FLAG-CDC20
Plasmid#221694PurposeMammalian expression of FLAG-tagged human CDC20DepositorInsertCDC20 (CDC20 Human)
ExpressionMammalianAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-O-FUW-CSRNP2-P2A-mCherry
Plasmid#203867PurposeTet-inducible lentiviral plasmid expressing CSRNP2-P2A-mCherry, with ORF specific barcode close to 3'LTR siteDepositorInsertCSRNP2 (CSRNP2 Human)
ExpressionMammalianAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FAS-COMP5AP-AviTag-9xHis
Plasmid#157106PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-DSCAML1(Trunc1)-COMP5AP-AviTag-9xHis
Plasmid#157607PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-DSCAM(Trunc1)-COMP5AP-AviTag-9xHis
Plasmid#157608PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-NOTCH3(Trunc1)-COMP5AP-AviTag-9xHis
Plasmid#157609PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CNTN6-COMP5AP-AviTag-9xHis
Plasmid#157579PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CNTN2-COMP5AP-AviTag-9xHis
Plasmid#157580PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CNTN3-COMP5AP-AviTag-9xHis
Plasmid#157582PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-ADGRF5-COMP5AP-AviTag-9xHis
Plasmid#157583PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-IGSF10(Trunc2)-COMP5AP-AviTag-9xHis
Plasmid#157584PurposeMammalian expression of cell-surface protein partial extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CNTN5-COMP5AP-AviTag-9xHis
Plasmid#157590PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-JAG2-COMP5AP-AviTag-9xHis
Plasmid#157591PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CHL1-COMP5AP-AviTag-9xHis
Plasmid#157592PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only