We narrowed to 1,598 results for: CAG promoter
-
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPN282
Plasmid#91665PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_multi1-3-MS2-Puro
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-42:AAVS1-mTagRFPT-CAAX
Plasmid#107580PurposeHomology arms, promoter and linker-mTagRFPT-CAAX sequence for internal insertion of CAGGS-driven mTagRFPT-CAAX at the AAVS1 safe harbor location in human cellsDepositorInsertAAVS1 Homology Arms with CAGGS-driven mTagRFPT-CAAX (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLKO.1 puro shSLC2A1-2
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgCh2-2-Blast
Plasmid#199645PurposeExpresses Cas9 and sgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3260
Plasmid#115457PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-5
Plasmid#193671PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-6
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only