We narrowed to 9,669 results for: Pol
-
Plasmid#38787DepositorInsert2545-3841 of MWPyV
ExpressionBacterialMutation5 SNPs in comparison to WD976PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p16
Plasmid#38786DepositorInsert214-1420 of MWPyV
ExpressionBacterialMutation3 SNPs compared to WD976PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p20
Plasmid#38785DepositorInsert1346-2623 of MWPyV
ExpressionBacterialMutation3 SNPs compared to WD976PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
K-p31
Plasmid#38790DepositorInsert3742-4573 of MWPyV
ExpressionBacterialMutationOne SNP in comparison to MA095PromoterlacAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
PAP-delta10-cHIS
Plasmid#21716DepositorInsertpolyA polymerase (PAP1 Budding Yeast)
TagsHISExpressionBacterialMutation30 amino acids off the c terminusAvailable SinceAug. 22, 2009AvailabilityAcademic Institutions and Nonprofits only -
pET-28a_6H-MMLV_RT_D524N-6H
Plasmid#166945PurposeBacterial expression of M-MLV reverse transcriptaseDepositorInsertgag-pol
Tags6X HisExpressionBacterialMutationD524N, H8YPromoterT7Available SinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA Q67H/N74D
Plasmid#217442PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q67H/N74D mutations in capsid (CA Q67H/N74D).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPapi
Plasmid#96921Purposeexpression of S aureus SaCas9 (SauCas9) and two pol III promoters for an Sa gRNA and an Sp gRNA. Intended to be used in SpCas9-expressing cell lines for dual Cas9 "Big Papi" screens. aka pXPR207.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv5
Plasmid#237452PurposeLentiviral backbone for expressing doxycycline (Dox)-inducible, Pol II-driven hybrid guide (hg)RNAs.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 12, 2026AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9
Plasmid#246054PurposeExpression of a sgRNA targeting the GRIN2B locus and SauCas9 under the same pol-III H1 promoterDepositorInsertSauCas9 and sgRNA(GRIN2B)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS22H-IRE
Plasmid#133905PurposePositive control when used in combination with pAWH-IRP. Expression of MS2BS-IRE site hybrid. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pLT237
Plasmid#174300PurposeReplicating plasmid with homology region for introducing PolCC669Y mutation. Confers thiamphenicol resistance.DepositorInsertPolC homology arm
ExpressionBacterialMutationchanged Cysteine 669 to TyrosineAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TSV (linearized in LT)
Plasmid#70033PurposepUC19-TSV (linearized in LT) contains a genome of the Trichodysplasia spinulosa-associated polyomaviruse (GenBank NC_014361) linearized and cloned in the Large T-antigen coding regionDepositorInsertTSPyV full genome, linearized in Large T-antigen
UseCloning vectorExpressionBacterialAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRevLCav2deltaC
Plasmid#60809Purposeto make truncation of yeast Rev3DepositorInsertREV3 (REV3 Budding Yeast)
ExpressionYeastMutationrev3ΔC encodes for Rev3 lacking the C-terminus (a…Available SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TSV (linearized in VP2)
Plasmid#70032PurposepUC19-TSV (linearized in VP2) contains a genome of the Trichodysplasia spinulosa-associated polyomaviruse (GenBank NC_014361) linearized and cloned in the VP2-coding regionDepositorInsertTSV full genome, linearized in VP2 gene
UseCloning vectorExpressionBacterialAvailable SinceDec. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 PARP2 E614Q
Plasmid#192545PurposepENTR plasmid Arabidopsis thaliana PARP2 CDS, E614Q mutation, no stop codonDepositorInsertpoly(ADP-ribose) polymerase 2 E614Q (AT3G18250 Mustard Weed)
UseGateway entry vectorMutationchanged Glu 614 to GlnAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR4 Ta-sro1 WWE-PARP
Plasmid#192548PurposepENTR plasmid Triticum aestivum sro1, amino acids 1-434, cultivar SR3, no stop codonDepositorInsertSIMILAR TO RCD ONE 1 (SRO1) WWE-PARP domains, cultivar Shanrong No. 3 (SR3)
UseGateway entry vectorAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPINF Ta-sro1 PARP
Plasmid#192549PurposeE. coli expression vector for Triticum aestivum sro1 PARP domain (amino acids 246-434)DepositorInsertSIMILAR TO RCD ONE 1 (SRO1) PARP domain, cultivar Shanrong No. 3 (SR3)
TagsHis6, 3C protease cleavage siteExpressionBacterial, Insect, and Mamm…PromoterT7 promoterAvailable SinceDec. 2, 2022AvailabilityAcademic Institutions and Nonprofits only