We narrowed to 11,363 results for: ENA
-
Plasmid#162123PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceFeb. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha2 clone3
Plasmid#162124PurposeLentiviral sgRNA plasmid targeting human AMPK alpha2DepositorInsertsgAMPK alpha2 (PRKAA2 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ 2xFLAG-2xSTREP_BACH1_Y11A
Plasmid#159131PurposeExpresses BACH1 in mammalian cellsDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
YCplac33-NAT_MCART1K91A
Plasmid#140592PurposeExpress MCART1K91A in S. cerevisiaeDepositorInsertSLC25A51 with 5' and 3' UTR of scNDT1 (SLC25A51 Human)
ExpressionYeastMutationcodon-optimized for expression in S. cerevisiae; …PromoterNDT1 promoter and 3'UTRAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g1)-PGKpuroBFP-W
Plasmid#105028PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Slc25a51-g2)-PGKpuroBFP-W
Plasmid#105029PurposeLentiviral gRNA plasmid targeting mouse Slc25a51 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Pou5f1-g1)-PGKpuroBFP-W
Plasmid#105035PurposeLentiviral gRNA plasmid targeting mouse Pou5f1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Kcmf1-g1)-PGKpuroBFP-W
Plasmid#105017PurposeLentiviral gRNA plasmid targeting mouse Kcmf1 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-27a-5p
Plasmid#103382PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-27a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-27a-5p target (MIR27A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceDec. 3, 2018AvailabilityAcademic Institutions and Nonprofits only