We narrowed to 10,394 results for: Ada;

#105767

Control vector for pKK series (encodes only SLIC arms (TEV-L and TEV-R)); expression without tag. Useful to design other vectors; any tag can be added.

Andrzej Dziembowski

Szczesny et al PLoS One. 2018 Mar 28;13(3):e0194887. do

Feb. 9, 2018

Academic Institutions and Nonprofits only

#208679

Expresses the genetically-encoded fluorescent neuropeptide Y (NPY) control sensor GRAB_NPYmut in neurons

Yulong Li

Wang et al Science. 2023 Nov 17;382(6672):eabq8173.

Oct. 13, 2023

Academic Institutions and Nonprofits only

#185326

For the mammalian expression of the human protein ApoE3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation

Pamela Silver

Veling et al ACS Synth Biol. 2022 Mar 18;11(3):1292-1

June 9, 2022

Academic Institutions and Nonprofits only

#85209

TRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Oct. 4, 2017

Academic Institutions and Nonprofits only

#117744

Open reading frame vector encoding DEDD

William Hahn

Hong et al Mol Cancer Res. 2019 Feb 18. pii: 1541-7

Feb. 21, 2019

Academic Institutions and Nonprofits only

#187929

Bacterial expression of heat-resistant obscure (Hero) protein Hero13

Yukihide Tomari

Tsuboyama et al PLoS Biol. 2020 Mar 12;18(3):e3000632. d

Oct. 17, 2022

Academic Institutions and Nonprofits only

#135298

Expresses Flag-tagged HROB in mammalian cells

Daniel Durocher

Hustedt et al Genes Dev. 2019 Oct 1;33(19-20):1397-141

March 2, 2020

Industry, Academic Institutions, and Nonprofits

#131138

UASp construct for over-expression of Drosophila Crk with N-terminal tandem Tomato and 3X FLAG tag. Compatible with PhiC31-mediated site-specific integration or classical P-element insertion.

Mark Peifer

Spracklen et al Mol Biol Cell. 2019 Jul 18:mbcE19050302.

Oct. 8, 2019

Academic Institutions and Nonprofits only

#136613

Dox-inducible lentiviral vector expressing mouse Klf4

Hans Schöler

Velychko et al Cell Stem Cell. 2019 Oct 30. pii: S1934-

March 25, 2020

Academic Institutions and Nonprofits only