We narrowed to 9,155 results for: Ott;
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pCMV-T7-PEmax-P2A-EGFP (LM1589)
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpCas9(D10A)-BPNLS-P2A-EGFP (NK350)
Plasmid#208292PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpCas9 A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpCas9-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpCas9(D10A)PromoterCMV and T7Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR207 SARS-CoV-2 NSP1 Delta RC
Plasmid#164522PurposeGateway-compatible Entry vector, with insert of mutated NSP1 CDS from SARS-CoV-2 isolate Wuhan-Hu-1 (amino acid substitutions K164A/H165A)DepositorInsertNSP1 Delta RC (ORF1ab )
ExpressionMammalianMutationInsert of NSP1 gene's CDS from SARS-CoV-2 is…Available SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA-RAD52-∆C
Plasmid#235677PurposeExpresses HA-tagged mutant human RAD52 in mammalian cells with a C-terminal deletion (Δ302-410 amino acids).DepositorAvailable SinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2K-LRL-mouse c-MYC-IRES-Luc2
Plasmid#109228PurposeFor Tol2 transposon-mediated stable expression of LRL, c-Myc and IRES-luciferaseDepositorAvailable SinceJune 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK mKate2-OGT D554N (Puro)
Plasmid#154292PurposeLentiviral vector encoding full length mKate2-2xFLAG-OGT (full length human O-GlcNAc transferase, D554N variant, no Ser/Thr glycosylation)DepositorInsertO-GlcNAc Transferase (OGT Human)
UseLentiviralTags2x FLAG and mKate2ExpressionMammalianMutationD554N mutation (Ser/Thr glycosylation-incompetent)PromoterPGKAvailable SinceMay 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-blast
Plasmid#167829PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Rat, Synthetic)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMX-HA-UbvG08-IRES-GFP
Plasmid#75030PurposeRetroviral vector with ubiquitin variant that binds to and occludes the ligand binding site of the 53BP1 Tudor domain (i53)DepositorInsertUbiquitin
UseRetroviralTagsHA and IRES-eGFPMutationUbvG08 with I44A mutation and no terminal GlycinesAvailable SinceJune 30, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits