We narrowed to 3,477 results for: GFP reporter gene
-
Plasmid#208824PurposeThe HDR-based surrogate reporter for validating HDR-editing activity of different gene editing tools as well as for helping to screen HDR-editing positive cells. Key Construct: CAG-PuroR-CMV-eGFP*(HDRDepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pPB-Neo-COVGT1-d2EGFP
Plasmid#201447PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT2-d2EGFP
Plasmid#201448PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT2_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT4-d2EGFP
Plasmid#201449PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT4_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-NeoCOVGT3-d2EGFP-mCherry
Plasmid#201450PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUASM1:GFPNLS-SV40pA
Plasmid#155123PurposeTol2 vector containing QUASM1 reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUASM1:GFPNLS
UseZebrafish expressionPromoterQUASM1-E1bAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286D)
Plasmid#127391PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286D)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to Aspartic acidPromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EGFP-Bulged-miR-19
Plasmid#91976PurposeEGFP reporter cell line with eight bulged miR-19 sitesDepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286A)
Plasmid#127390PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-HA-GFP11-KDEL
Plasmid#177722PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-M3(T3D)471-721
Plasmid#56657PurposeGFP reporter for cytoplasmic inclusions formed by the fused, C-terminal region of protein muNS from mammalian orthoreovirus Type 3 DearingDepositorInsertM3(T3D)421-721
TagsEGFPExpressionMammalianMutationinsert encodes aa 471-721 + native stop codon of …PromoterCMV-IEAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
EW410 IKZF1tar x8-H2B-GFP
Plasmid#236156PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight IKZF1 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight IKZF1 binding sit…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- sfGFP
Plasmid#190051PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
EW409 ZNF250tarv3 x8-H2B-GFP
Plasmid#236133PurposeFuorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with eight ZNF250 binding sites upstreamDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with eight ZNF250 binding si…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
SCN1Aprom(1-500)-H2B-GFP
Plasmid#236162PurposeFluorescent reporter encoding H2B-GFP fusion under control of E1b minimal promoter with the SCN1a promoter region encompassing 500 bp upstream of its transcriptional start siteDepositorInsertH2B (H2BC11 Human)
TagsEGFPExpressionMammalianPromoterE1b minimal promoter with the SCN1a promoter regi…Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pYjjZ-RBS- sfGFP
Plasmid#190054PurposeGFP containing reporter plasmid expressing it under the control of the reportedely OxyR/H2O2 inducible pYjjZ promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pKatG-RBS- sfGFP
Plasmid#190053PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pKatG promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pOxyS-RBS- sfGFP
Plasmid#190052PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pOxyS promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-DM-HA-GFP11-KDEL
Plasmid#177723PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFlucDM
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only