We narrowed to 16,173 results for: grna
-
Plasmid#49331PurposeExpresses sgRNA targeting yellow gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertsUseCRISPRTags3xFLAG and NLSExpressionInsectMutationHuman codon optimisedPromoterActin-5c and Drosophila U6Available SinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only
-
FEN1 C10.3 gRNA
Plasmid#90689Purpose3rd generation lentiviral gRNA plasmid targeting human FEN1DepositorInsertFEN1 (Guide Designation C10.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Spy CCR5-pegRNA
Plasmid#169856PurposeSpyCas9-pegRNA for CCR5DepositorInsertSpy CCR5-pegRNA
ExpressionMammalianPromoterhuman U6 promoterAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK4 gRNA (BRDN0001145948)
Plasmid#75875Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162291)
Plasmid#77097Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM33 gRNA (BRDN0001162239)
Plasmid#77098Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM33DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2B gRNA (BRDN0001145952)
Plasmid#76714Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TRIM24 gRNA (BRDN0001145637)
Plasmid#77887Purpose3rd generation lentiviral gRNA plasmid targeting human TRIM24DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001145974)
Plasmid#75497Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SP6-sgRNA-scaffold
Plasmid#47912PurposeScaffold into which clone a 20 bp targeting sequence to generate a plasmid for in vitro transcription of an sgRNA using SP6 RNA polymerase for use in CRISPR-Cas by RNA injectionDepositorTypeEmpty backboneUseCRISPRTagssgRNA 3' endExpressionWormPromoterSP6Available SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) TFRC
Plasmid#74709PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of TFRC mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of TFRC mRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-SpCas9-sgRNA
Plasmid#179582PurposeExpresses spCas9 and gRNA that targets ColE1 plasmids for curingDepositorInsertCas9
ExpressionBacterialAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001149081)
Plasmid#76394Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
SMC6 G4.4 gRNA
Plasmid#90899Purpose3rd generation lentiviral gRNA plasmid targeting human SMC6DepositorInsertSMC6 (Guide Designation G4.4)
UseCRISPR and LentiviralPromoterU6Available SinceAug. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
SMC6 G3.4 gRNA
Plasmid#90898Purpose3rd generation lentiviral gRNA plasmid targeting human SMC6DepositorInsertSMC6 (Guide Designation G3.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-TTF-1-gRNA
Plasmid#101857PurposeIntroducing a gRNA targeting human TTF-1 (NKX2-1) into cellsDepositorInsertgRNA targeting TTF-1 (NKX2-1 Human)
UseLentiviralAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
TK1 gRNA (BRDN0001145069)
Plasmid#76424Purpose3rd generation lentiviral gRNA plasmid targeting human TK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRA gRNA (BRDN0001148373)
Plasmid#75493Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001145809)
Plasmid#77923Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only