We narrowed to 311 results for: IPTG
-
Plasmid#191352PurposeClostridium expression vector (pAMB1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod2E-GG
Plasmid#191345PurposeClostridium expression vector (pBP1 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod3E-GG
Plasmid#191348PurposeClostridium expression vector (pCB102 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQmod4E-GG
Plasmid#191351PurposeClostridium expression vector (pCD6 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196M wgMDH
Plasmid#204273PurposeBacterial expression of R196M wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196MAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 D193E wgMDH
Plasmid#204269PurposeBacterial expression of D193E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationD193EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodA
Plasmid#89612PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase A protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase A
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - APX
Plasmid#89618PurposeExpresses recombinant 6HIS tagged T. cruzi ascorbate-dependent tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertAscorbate dependent Tryparedoxin peroxidase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - CPX
Plasmid#89620Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi cytoplasmic tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertCytosolic Tryparedoxin peroxidase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - SodB
Plasmid#89613PurposeExpresses recombinant 6HIS tagged T. cruzi superoxide dismutase B protein in E. coli upon IPTG inductionDepositorInsertSuperoxide dismutase B
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NDH
Plasmid#89626PurposeExpresses recombinant 6HIS tagged T. cruzi NADP-dependent oxidoreductase in E. coli upon IPTG inductionDepositorInsertNAD(P)-dependent oxidoreductase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAPH07
Plasmid#234345PurposeLibrary-scale IPTG-inducible gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertType II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPH021
Plasmid#234346PurposeLibrary-scale IPTG-inducible single transcript dual-gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertsType II dCas9 sgRNA
Type II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196E wgMDH
Plasmid#204272PurposeBacterial expression of R196E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130Q wgMDH
Plasmid#204268PurposeBacterial expression of R130Q wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR130QAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 M66L wgMDH
Plasmid#204247PurposeBacterial expression of M66L wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationM66LAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 M91Q wgMDH
Plasmid#204250PurposeBacterial expression of M91Q wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationM91QAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 D87L wgMDH
Plasmid#204248PurposeBacterial expression of D87L wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationD87LAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQmod3S-GG
Plasmid#191349PurposeClostridium expression vector (pCB102 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET21a - MPX
Plasmid#89619Purpose[Edit] Expresses recombinant 6HIS tagged T. cruzi mitochondrial tryparedoxin peroxidase protein in E. coli upon IPTG inductionDepositorInsertMitocondrial Tryparedoxin peroxidase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - EtfA
Plasmid#89616PurposeExpresses recombinant 6HIS tagged T. cruzi electron transfer flavoprotein A in E. coli upon IPTG inductionDepositorInsertElectron transport flavoprotein alpha subunit
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - EtfB
Plasmid#89617PurposeExpresses recombinant 6HIS tagged T. cruzi electron transfer flavoprotein B in E. coli upon IPTG inductionDepositorInsertelectron-transfer-flavoprotein, alpha polypeptide
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - TDR
Plasmid#89627PurposeExpresses recombinant 6HIS tagged T. cruzi thiol dependent reductase in E. coli upon IPTG inductionDepositorInsertthiol dependent reductase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET21a - NFDD
Plasmid#89624PurposeExpresses recombinant 6HIS tagged T. cruzi NAD-FAD–dependent dehydrogenase in E. coli upon IPTG inductionDepositorInsertNAD/FAD dependent dehydrogenase
Tags6HIS and T7 tag (gene 10 leader)ExpressionBacterialAvailable SinceApril 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-p50-ligase
Plasmid#87742PurposeIPTG-inducible expression of p50-ligase fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and human p50/NF-kB (amino acids 40-366)ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-sso7d-ligase
Plasmid#87745PurposeIPTG-inducible expression of sso7d-ligase fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and codon optimized sso7d (Sulfolobus solfa…ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEC3109 (pSpy1C-Plac(1)_ffluc)
Plasmid#218514Purposereplicative E. coli-S. pyogenes shuttle plasmid for IPTG-inducible expression of the Firefly luciferase in a strain expressing lacI repressorDepositorInsertffluc
UseLuciferaseExpressionBacterialMutationdeletion of mrfp cassette, mutagenesis of the RBS…PromoterPlac(1)Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TnY
Plasmid#163975PurposeIPTG-inducible expression of Transposon TnY fused to Mxe Intein and Chitin-binding domain.DepositorInsertTnY
TagsMxe intein - Chitin-binding domainExpressionBacterialAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHT-6xR.ads-PxylA-DI
Plasmid#47386PurposeExpresses ads under Pgrac promoter (inducible by IPTG) and expresses dxs and idi under PxylA promoter (inducible by xylose) in bacteriaDepositorInsertsads
dxs
idi
Tags6xR and HisExpressionBacterialPromoterPgrac and PxylAAvailable SinceOct. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQE60 Q58L wgMDH
Plasmid#204246PurposeBacterial expression of Q58L wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationQ58LPromoterT5Available SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase-cTF
Plasmid#87743PurposeIPTG-inducible expression of ligase-cTF fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and cTF (chimeric transcription factor base…ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEC3111 (pSpy1C-Plac(3)_ffluc)
Plasmid#218778Purposereplicative E. coli-S. pyogenes shuttle plasmid for IPTG-inducible expression of the Firefly luciferase in a strain expressing lacI repressorDepositorInsertffluc
UseLuciferaseExpressionBacterialMutationdeletion of mrfp cassette, mutagenesis of the RBS…PromoterPlac(3)Available SinceSept. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY118A
Plasmid#182958PurposepSC101 ori, chl34 resistant. Cas9 induced at 0.4 μg/ml anhydrotetracycline, recombineering proteins induced by a 15 min heat-shock at 42°C, I-Scel (induced by 0.1 mM IPTG) is to cleave the pDonor2.DepositorInsertsCas9
Gam, Beta, Exo
I-scel
Available SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
R0010 (pLacI)_AB
Plasmid#66004PurposeMoClo Basic Part: Controllable promoter - pLacI - lacI regulated (repressed by LacI+CAP. LacI, C0012, inhibited by IPTG) [A:R0010:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase-pprA
Plasmid#87744PurposeIPTG-inducible expression of ligase-pprA fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and codon optimized pprA (from Deinococcus …ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQE60 G121A wgMDH
Plasmid#204252PurposeBacterial expression of G121A wgMDH with IPTG induction - Active site loop mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationG121AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 P123A wgMDH
Plasmid#204254PurposeBacterial expression of P123A wgMDH with IPTG induction - Active site loop mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationP123AAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 G127F wgMDH
Plasmid#204264PurposeBacterial expression of G127F wgMDH with IPTG induction - Active site loop mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationG127FAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 P126R wgMDH
Plasmid#204261PurposeBacterial expression of P126R wgMDH with IPTG induction - Active site loop mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationP126RAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only