We narrowed to 7,026 results for: SIM
-
Viral Prep#154948-AAV9PurposeReady-to-use AAV9 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only
-
hSyn-DIO-somBiPOLES-mCerulean (AAV5)
Viral Prep#154951-AAV5PurposeReady-to-use AAV5 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV5)
Viral Prep#154948-AAV5PurposeReady-to-use AAV5 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154948-AAVrgPurposeReady-to-use AAV Retrograde particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154951-AAVrgPurposeReady-to-use AAV Retrograde particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
Antibody#218107-rAbPurposeAnti-V5 tag chimeric recombinant antibody with fused mouse variable and rabbit constant domains; binds to GKPIPNPLLGLDST sequence.DepositorRecommended ApplicationsWestern BlotSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMay 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
hSyn-DIO-somBiPOLES-mCerulean
Plasmid#154951PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorHas ServiceAAV Retrograde, AAV5, and AAV9InsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-somBiPOLES-mCerulean
Plasmid#154945PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean
Plasmid#154948PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorHas ServiceAAV Retrograde, AAV5, and AAV9InsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterCaMKIIa(0.4)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-GtACR2-ChRmine-tandem-eYFP
Plasmid#192580PurposeAAV-vector for bidirectional optogenetic manipulation of neuronsDepositorInsertsomBiPOLES
UseAAVTagsEYFP- soma-targeting motif from Kv2.1 channelExpressionMammalianPromoterhuman synapsinAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Ef1a-DIO-BiPOLES-mCerulean
Plasmid#154949PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVExpressionMammalianPromoterEf1-alphaAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-BiPOLES-mCerulean
Plasmid#154950PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertBiPOLES
UseAAVExpressionMammalianPromoterhuman synapsinAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJOP-HTT-HR18Q
Plasmid#87228PurposeHTT HR arms with 18 CAG repeats and piggyBac selection cassetteDepositorInsert1.7kb HTT 5' homology arm, 2.5kb HTT 3' homology arm
ExpressionMammalianPromoterEF1a driving selection cassetteAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
ABE8e-Cas9NG
Plasmid#203328PurposePlasmid for bacterial purification of codon optimized ABE8e-Cas9NGDepositorInsertABE8e-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
evoFERNY-Cas9NG
Plasmid#203329PurposePlasmid for bacterial purification of codon optimized evoFERNY-Cas9NGDepositorInsertevoFERNY-Cas9NG
UseCRISPRTagsHis-tagExpressionBacterialAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-Octo_VirD2_NLS-Cas9-6xHis
Plasmid#232296PurposeExpresses Cas9 protein fused with octopine-type VirD2-originating NLSDepositorInsertOcto_VirD2_NLS-Cas9-6xHis
UseCRISPRTags6xHis and Octopine-type VirD2-derived NLSExpressionBacterialPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-NTID194-GSQ-PMLiva3MAS-P2A-BLAST
Plasmid#208039PurposeEnables constitutive expression of N-terminal Split-TurboID-fused PML (isoform IVa; 3MAS mutant; K>R sumoylation sites, mutated SIM); selection with blasticidinDepositorInsertPML (isoform IVa; 3MAS) (PML Human)
UseLentiviralTagsFLAG, N-terminal Split-TurboIDMutation3MAS mutant: K65R, K160R and K490R; mutated SIMPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
DSPQ-HTT-TALEN2 BSD
Plasmid#92246PurposeTALEN targeting downstream of HTT gene (ELD) with Blasticidin selection, forms obligate heterodimer with DSPQ-HTT-TALEN1 ZEO. TALEN: NN, HD, NN, NN, HD, NG, NN, NI, NN, NN, HD, NI, NN, HD, NI, NNDepositorInsertTALEN
UseTALENPromoterCAGAvailable SinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only